close

Darwin Core List of Terms

Darwin Core List of Terms

Title
Darwin Core List of Terms
Date version issued
2026-05-26
Date created
2020-08-12
Part of TDWG Standard
http://www.tdwg.org/standards/450
This version
http://rs.tdwg.org/dwc/doc/list/2026-05-26
Latest version
http://rs.tdwg.org/dwc/doc/list/
Previous version
http://rs.tdwg.org/dwc/doc/list/2025-07-10
Abstract
Darwin Core is a vocabulary standard for transmitting information about biodiversity. This document lists all terms in namespaces currently used in the vocabulary.
Contributors
John Wieczorek (VertNet), Peter Desmet (Instituut voor Natuur- en Bosonderzoek (INBO)), Steve Baskauf (Vanderbilt University Libraries), Tim Robertson (Global Biodiversity Information Facility), Markus Döring (Global Biodiversity Information Facility), Quentin Groom (Botanic Garden Meise), Stijn Van Hoey (Instituut voor Natuur- en Bosonderzoek (INBO)), David Bloom (VertNet), Paula Zermoglio (VertNet), Robert Guralnick (University of Florida), John Deck (Genomic Biodiversity Working Group), Gail Kampmeier (Illinois Natural History Survey), Dave Vieglais (KU Natural History Museum), Renato De Giovanni (Centro de Referência em Informação Ambiental), Campbell Webb (TDWG RDF/OWL Task Group), Paul J. Morris (Harvard University Herbaria/Museum of Comparative Zoölogy), Mark Schildhauer (National Center for Ecological Analysis and Synthesis), Sophia Ratcliffe (National Biodiversity Network Trust), Teresa J. Mayfield-Meyer (The University of New Mexico, Arctos), Christian Bölling (Museum für Naturkunde Berlin - Leibniz-Institut für Evolutions- und Biodiversitätsforschung)
Creator
Darwin Core Maintenance Group
Bibliographic citation
Darwin Core Maintenance Group. 2026. Darwin Core List of Terms. Biodiversity Information Standards (TDWG). http://rs.tdwg.org/dwc/doc/list/2026-05-26

1 Introduction (Informative)

This document contains terms that are part of the most recent version of the Darwin Core vocabulary (http://rs.tdwg.org/version/dwc/2026-05-26).

This document provides a comprehensive list of terms, from multiple namespaces, that have ever been recommended for use in Darwin Core. The status of some terms, as noted in their metadata, is deprecated or superseded and such terms should no longer be used. Terms from namespaces that contain only deprecated terms are not included in this document, but metadata about those terms can be retrieved by dereferencing their IRIs.

For a simplified list that contains only the currently recommended terms, see the Darwin Core Quick Reference Guide.

1.1 Status of the content of this document

Sections 1 and 3 are non-normative.

Section 2 is normative.

In Section 4, the values of the Term IRI and Definition are normative. The values of Term Name are non-normative, although one can expect that the namespace abbreviation prefix is one commonly used for the term namespace. Label and the values of all other properties (such as Examples and Notes) are non-normative.

1.2 RFC 2119 key words

The key words “MUST”, “MUST NOT”, “REQUIRED”, “SHALL”, “SHALL NOT”, “SHOULD”, “SHOULD NOT”, “RECOMMENDED”, “MAY”, and “OPTIONAL” in this document are to be interpreted as described in BCP 14 [RFC 2119] and [RFC 8174] when, and only when, they appear in all capitals, as shown here.

1.3 Namespace abbreviations

The following namespace abbreviations are used in this document:

abbreviation IRI
ac: http://rs.tdwg.org/ac/terms/
dwc: http://rs.tdwg.org/dwc/terms/
dwciri: http://rs.tdwg.org/dwc/iri/
dc: http://purl.org/dc/elements/1.1/
dcterms: http://purl.org/dc/terms/

2 Use of Terms

Due to the requirements of Section 1.4.3 of the Darwin Core RDF Guide, properties in the dwciri: namespace MUST be used with IRI values. Properties in the dwc: and dc: namespaces are generally expected to have string literal values. Values for properties in the dcterms: namespace will depend on the details of the term. See Section 3 of the Darwin Core RDF Guide for details.

3 Term indices

3.1 Index By Term Name

(See also 3.2 Index By Label)

Classes

dcterms:Agent | dwc:Assertion | dcterms:BibliographicResource | dwc:Dataset | dwc:Event | dwc:EventAttribute | dwc:EventMeasurement | dwc:FossilSpecimen | dwc:GeologicalContext | dwc:HumanObservation | dwc:Identification | dwc:LivingSpecimen | dcterms:Location | dwc:MachineObservation | dwc:MaterialCitation | dwc:MaterialEntity | dwc:MaterialSample | dwc:MeasurementOrFact | ac:Media | dwc:MolecularProtocol | dwc:NucleotideAnalysis | dwc:NucleotideSequence | dwc:Occurrence | dwc:OccurrenceMeasurement | dwc:Organism | dwc:OrganismInteraction | dwc:PreservedSpecimen | dwc:Protocol | dwc:Provenance | dwc:ResourceRelationship | dwc:Sample | dwc:SampleAttribute | dwc:SamplingEvent | dwc:SamplingLocation | dwc:Taxon | dwc:UsagePolicy

Record level

dwc:accordingTo | dwc:accuracy | dwc:agentRoleOrder | dwc:basisOfRecord | dwc:collectionCode | dwc:collectionID | dwc:dataGeneralizations | dwc:datasetID | dwc:datasetName | dwc:DwCType | dwc:dynamicProperties | dwc:feedbackURL | dwc:Generalizations | dwc:informationWithheld | dwc:institutionCode | dwc:institutionID | dwc:ownerInstitutionCode

Dublin Core legacy namespace

dc:language | dc:type

Dublin Core terms namespace

dcterms:accessRights | dcterms:bibliographicCitation | dcterms:language | dcterms:license | dcterms:modified | dcterms:references | dcterms:rights | dcterms:rightsHolder | dcterms:type

Agent

dwc:agentID | dwc:agentRemarks | dwc:agentType

Assertion

dwc:assertionBy | dwc:assertionEffectiveDate | dwc:assertionError | dwc:assertionID | dwc:assertionMadeDate | dwc:assertionProtocols | dwc:assertionReferences | dwc:assertionRemarks | dwc:assertionType | dwc:assertionUnit | dwc:assertionValue | dwc:verbatimAssertionType

Bibliographic Resource

dwc:referenceID | dwc:referenceRemarks | dwc:referenceType

Event

dwc:day | dwc:EarliestDateCollected | dwc:endDayOfYear | dwc:EndTimeOfDay | dwc:eventAttributes | dwc:eventCategory | dwc:eventDate | dwc:eventID | dwc:eventRemarks | dwc:eventTime | dwc:eventType | dwc:fieldNotes | dwc:fieldNumber | dwc:habitat | dwc:LatestDateCollected | dwc:month | dwc:parentEventID | dwc:sampledSubstrateCategory | dwc:sampledSubstrateLayer | dwc:sampleSizeUnit | dwc:sampleSizeValue | dwc:samplingEffort | dwc:samplingProtocol | dwc:startDayOfYear | dwc:StartTimeOfDay | dwc:verbatimEventDate | dwc:year

Geological Context

dwc:bed | dwc:earliestAgeOrLowestStage | dwc:earliestEonOrLowestEonothem | dwc:earliestEpochOrLowestSeries | dwc:earliestEraOrLowestErathem | dwc:earliestPeriodOrLowestSystem | dwc:formation | dwc:geologicalContextID | dwc:group | dwc:highestBiostratigraphicZone | dwc:latestAgeOrHighestStage | dwc:latestEonOrHighestEonothem | dwc:latestEpochOrHighestSeries | dwc:latestEraOrHighestErathem | dwc:latestPeriodOrHighestSystem | dwc:lithostratigraphicTerms | dwc:lowestBiostratigraphicZone | dwc:member

Identification

dwc:dateIdentified | dwc:identificationAttributes | dwc:identificationID | dwc:identificationQualifier | dwc:identificationReferences | dwc:identificationRemarks | dwc:identificationType | dwc:identificationVerificationStatus | dwc:identifiedBy | dwc:identifiedByID | dwc:isAcceptedIdentification | dwc:PreviousIdentifications | dwc:taxonFormula | dwc:typeStatus | dwc:verbatimIdentification

Location

dwc:continent | dwc:coordinatePrecision | dwc:coordinateUncertaintyInMeters | dwc:country | dwc:countryCode | dwc:county | dwc:decimalLatitude | dwc:decimalLongitude | dwc:footprintSpatialFit | dwc:footprintSRS | dwc:footprintWKT | dwc:geodeticDatum | dwc:georeferencedBy | dwc:georeferencedDate | dwc:georeferenceProtocol | dwc:georeferenceRemarks | dwc:georeferenceSources | dwc:higherGeography | dwc:higherGeographyID | dwc:island | dwc:islandGroup | dwc:locality | dwc:locationAccordingTo | dwc:locationAttributes | dwc:locationID | dwc:locationRemarks | dwc:maximumDepthInMeters | dwc:maximumDistanceAboveSurfaceInMeters | dwc:maximumElevationInMeters | dwc:minimumDepthInMeters | dwc:minimumDistanceAboveSurfaceInMeters | dwc:minimumElevationInMeters | dwc:municipality | dwc:pointRadiusSpatialFit | dwc:preferredSpatialRepresentation | dwc:SamplingLocationID | dwc:SamplingLocationRemarks | dwc:siteNumber | dwc:stateProvince | dwc:verbatimCoordinates | dwc:verbatimCoordinateSystem | dwc:verbatimDepth | dwc:verbatimElevation | dwc:verbatimLatitude | dwc:verbatimLocality | dwc:verbatimLongitude | dwc:verbatimSRS | dwc:verticalDatum | dwc:waterBody

Material Entity

dwc:associatedSequences | dwc:catalogNumber | dwc:digitalSpecimenID | dwc:discipline | dwc:disposition | dwc:materialEntityCategory | dwc:materialEntityID | dwc:materialEntityRemarks | dwc:materialEntityType | dwc:objectQuantity | dwc:objectQuantityType | dwc:otherCatalogNumbers | dwc:preparations | dwc:typeOfType | dwc:typifiedName | dwc:verbatimLabel

Material Sample

dwc:materialSampleID

Measurement or Fact

dwc:measurementAccuracy | dwc:measurementDeterminedBy | dwc:measurementDeterminedDate | dwc:measurementID | dwc:measurementMethod | dwc:measurementRemarks | dwc:measurementType | dwc:measurementUnit | dwc:measurementValue | dwc:parentMeasurementID | dwc:verbatimMeasurementType

Media

No properties are currently organized in this class.

Molecular Protocol

dwc:assayType | dwc:molecularProtocolID

Nucleotide Analysis

dwc:processedTotalReadCount | dwc:readCount

Nucleotide Sequence

dwc:nucleotideSequenceRemarks | dwc:sequence

Occurrence

dwc:associatedMedia | dwc:associatedOccurrences | dwc:associatedReferences | dwc:associatedTaxa | dwc:behavior | dwc:caste | dwc:CatalogNumberNumeric | dwc:degreeOfEstablishment | dwc:establishmentMeans | dwc:georeferenceVerificationStatus | dwc:individualCount | dwc:individualID | dwc:lifeStage | dwc:occurrenceAttributes | dwc:occurrenceDetails | dwc:occurrenceID | dwc:occurrenceRemarks | dwc:occurrenceStatus | dwc:organismQuantity | dwc:organismQuantityType | dwc:pathway | dwc:recordedBy | dwc:recordedByID | dwc:recordNumber | dwc:reproductiveCondition | dwc:sex | dwc:vitality

Organism

dwc:associatedOrganisms | dwc:causeOfDeath | dwc:organismID | dwc:organismName | dwc:organismRemarks | dwc:organismScope | dwc:previousIdentifications

Organism Interaction

dwc:organismInteractionDescription | dwc:organismInteractionID | dwc:organismInteractionType

Protocol

dwc:protocolDescription | dwc:protocolID | dwc:protocolReferences | dwc:protocolRemarks | dwc:protocolType

Provenance

ac:fundingAttribution | dwc:fundingAttributionID | dwc:projectID | dwc:projectTitle

Resource Relationship

dwc:RelatedBasisOfRecord | dwc:relatedResourceID | dwc:relatedResourceType | dwc:relationshipAccordingTo | dwc:relationshipEstablishedDate | dwc:relationshipOfResource | dwc:relationshipOfResourceID | dwc:relationshipRemarks | dwc:resourceID | dwc:resourceRelationshipID

Taxon

dwc:acceptedNameUsage | dwc:acceptedNameUsageID | dwc:acceptedScientificName | dwc:acceptedScientificNameID | dwc:AcceptedTaxon | dwc:AcceptedTaxonID | dwc:acceptedTaxonID | dwc:acceptedTaxonName | dwc:acceptedTaxonNameID | dwc:basionym | dwc:basionymID | dwc:binomial | dwc:class | dwc:cultivarEpithet | dwc:family | dwc:genericName | dwc:genus | dwc:higherClassification | dwc:HigherTaxon | dwc:higherTaxonconceptID | dwc:HigherTaxonID | dwc:higherTaxonName | dwc:higherTaxonNameID | dwc:infragenericEpithet | dwc:infraspecificEpithet | dwc:kingdom | dwc:nameAccordingTo | dwc:nameAccordingToID | dwc:namePublicationID | dwc:namePublishedIn | dwc:namePublishedInID | dwc:namePublishedInYear | dwc:nomenclaturalCode | dwc:nomenclaturalStatus | dwc:order | dwc:originalNameUsage | dwc:originalNameUsageID | dwc:parentNameUsage | dwc:parentNameUsageID | dwc:phylum | dwc:scientificName | dwc:scientificNameAuthorship | dwc:scientificNameID | dwc:scientificNameRank | dwc:specificEpithet | dwc:subfamily | dwc:subgenus | dwc:subtribe | dwc:superfamily | dwc:taxonAccordingTo | dwc:taxonAttributes | dwc:taxonConceptID | dwc:TaxonID | dwc:taxonID | dwc:taxonNameID | dwc:taxonomicStatus | dwc:taxonRank | dwc:taxonRemarks | dwc:tribe | dwc:verbatimScientificNameRank | dwc:verbatimTaxonRank | dwc:vernacularName

Usage Policy

No properties are currently organized in this class.

IRI-value terms

dwciri:assayType | dwciri:assertionBy | dwciri:assertionType | dwciri:assertionUnit | dwciri:assertionValue | dwciri:behavior | dwciri:caste | dwciri:dataGeneralizations | dwciri:degreeOfEstablishment | dwciri:discipline | dwciri:disposition | dwciri:earliestGeochronologicalEra | dwciri:establishmentMeans | dwciri:eventCategory | dwciri:eventType | dwciri:fieldNotes | dwciri:fieldNumber | dwciri:footprintSRS | dwciri:footprintWKT | dwciri:fromLithostratigraphicUnit | dwciri:fundingAttribution | dwciri:geodeticDatum | dwciri:georeferencedBy | dwciri:georeferenceProtocol | dwciri:georeferenceSources | dwciri:georeferenceVerificationStatus | dwciri:habitat | dwciri:identificationQualifier | dwciri:identificationType | dwciri:identificationVerificationStatus | dwciri:identifiedBy | dwciri:inCollection | dwciri:inDataset | dwciri:inDescribedPlace | dwciri:informationWithheld | dwciri:latestGeochronologicalEra | dwciri:lifeStage | dwciri:locationAccordingTo | dwciri:materialEntityCategory | dwciri:materialEntityType | dwciri:measurementDeterminedBy | dwciri:measurementMethod | dwciri:measurementType | dwciri:measurementUnit | dwciri:measurementValue | dwciri:objectQuantityType | dwciri:occurrenceStatus | dwciri:organismInteractionType | dwciri:organismQuantityType | dwciri:organismScope | dwciri:pathway | dwciri:preferredSpatialRepresentation | dwciri:preparations | dwciri:protocolType | dwciri:recordedBy | dwciri:recordNumber | dwciri:reproductiveCondition | dwciri:sampledSubstrateCategory | dwciri:sampledSubstrateLayer | dwciri:sampleSizeUnit | dwciri:samplingProtocol | dwciri:sex | dwciri:siteNumber | dwciri:taxonFormula | dwciri:toDigitalSpecimen | dwciri:toTaxon | dwciri:typeStatus | dwciri:verbatimCoordinateSystem | dwciri:verbatimSRS | dwciri:verticalDatum | dwciri:vitality

3.2 Index By Label

(See also 3.1 Index By Term Name)

Classes

Agent | Assertion | Bibliographic Resource | Dataset | Event | Event Attribute | Event Measurement | Fossil Specimen | Geological Context | Human Observation | Identification | Living Specimen | Location | Machine Observation | Material Citation | Material Entity | Material Sample | Measurement Or Fact | Media Entity | Molecular Protocol | Nucleotide Analysis | Nucleotide Sequence | Occurrence | Occurrence Measurement | Organism | Organism Interaction | Preserved Specimen | Protocol | Provenance | Resource Relationship | Sample | Sample Attribute | Sampling Event | Sampling Location | Taxon | Usage Policy

Record level

According To | Accuracy | Agent Role Order | Basis Of Record | Collection Code | Collection ID | Darwin Core Type | Data Generalizations | Dataset ID | Dataset Name | Dynamic Properties | Feedback URL | Generalizations | Information Withheld | Institution Code | Institution ID | Owner Institution Code

Dublin Core legacy namespace

Language | Type

Dublin Core terms namespace

Access Rights | Bibliographic Citation | Date Modified | Language | License | References | Rights | Rights Holder | Type

Agent

Agent ID | Agent Remarks | Agent Type

Assertion

Assertion By | Assertion Effective Date | Assertion Error | Assertion ID | Assertion Made Date | Assertion Protocols | Assertion References | Assertion Remarks | Assertion Type | Assertion Unit | Assertion Value | Verbatim Assertion Type

Bibliographic Resource

Reference ID | Reference Remarks | Reference Type

Event

Day | Earliest Date Collected | End Day Of Year | End Time of Day | Event Attributes | Event Category | Event Date | Event ID | Event Remarks | Event Time | Event Type | Field Notes | Field Number | Habitat | Latest Date Collected | Month | Parent Event ID | Sample Size Unit | Sample Size Value | Sampled Substrate Category | Sampled Substrate Layer | Sampling Effort | Sampling Protocol | Start Day Of Year | Start Time of Day | Verbatim EventDate | Year

Geological Context

Bed | Earliest Age Or Lowest Stage | Earliest Eon Or Lowest Eonothem | Earliest Epoch Or Lowest Series | Earliest Era Or Lowest Erathem | Earliest Period Or Lowest System | Formation | Geological Context ID | Group | Highest Biostratigraphic Zone | Latest Age Or Highest Stage | Latest Eon Or Highest Eonothem | Latest Epoch Or Highest Series | Latest Era Or Highest Erathem | Latest Period Or Highest System | Lithostratigraphic Terms | Lowest Biostratigraphic Zone | Member

Identification

Date Identified | Identification Attributes | Identification ID | Identification Qualifier | Identification References | Identification Remarks | Identification Type | Identification Verification Status | Identified By | Identified By ID | Is Accepted Identification | Previous Identifications | Taxon Formula | Type Status | Verbatim Identification

Location

Continent | Coordinate Precision | Coordinate Uncertainty In Meters | Country | Country Code | Decimal Latitude | Decimal Longitude | First Order Division | Footprint SRS | Footprint Spatial Fit | Footprint WKT | Geodetic Datum | Georeference Protocol | Georeference Remarks | Georeference Sources | Georeferenced By | Georeferenced Date | Higher Geography | Higher Geography ID | Island | Island Group | Locality | Location According To | Location Attributes | Location ID | Location Remarks | Maximum Depth In Meters | Maximum Distance Above Surface In Meters | Maximum Elevation In Meters | Minimum Depth In Meters | Minimum Distance Above Surface In Meters | Minimum Elevation In Meters | Point Radius Spatial Fit | Preferred Spatial Representation | Sampling Location ID | Sampling Location Remarks | Second Order Division | Site Number | Third Order Division | Verbatim Coordinate System | Verbatim Coordinates | Verbatim Depth | Verbatim Elevation | Verbatim Latitude | Verbatim Locality | Verbatim Longitude | Verbatim SRS | Vertical Datum | Water Body

Material Entity

Associated Sequences | Catalog Number | Digital Specimen ID | Discipline | Disposition | Material Entity Category | Material Entity ID | Material Entity Remarks | Material Entity Type | Object Quantity | Object Quantity Type | Other Catalog Numbers | Preparations | Type Of Type | Typified Name | Verbatim Label

Material Sample

Material Sample ID

Measurement or Fact

Measurement Accuracy | Measurement Determined By | Measurement Determined Date | Measurement ID | Measurement Method | Measurement Remarks | Measurement Type | Measurement Unit | Measurement Value | Parent Measurement ID | Verbatim Measurement Type

Media

No properties are currently organized in this class.

Molecular Protocol

Assay Type | Molecular Protocol ID

Nucleotide Analysis

Processed Total Read Count | Read Count

Nucleotide Sequence

Nucleotide Sequence Remarks | Sequence

Occurrence

Associated Media | Associated Occurrences | Associated References | Associated Taxa | Behavior | Caste | Catalog Number Numeric | Degree of Establishment | Establishment Means | Georeference Verification Status | Individual Count | Individual ID | Life Stage | Occurrence Attributes | Occurrence Details | Occurrence ID | Occurrence Remarks | Occurrence Status | Organism Quantity | Organism Quantity Type | Pathway | Record Number | Recorded By | Recorded By ID | Reproductive Condition | Sex | Vitality

Organism

Associated Organisms | Cause Of Death | Organism ID | Organism Name | Organism Remarks | Organism Scope | Previous Identifications

Organism Interaction

Organism Interaction Description | Organism Interaction ID | Organism Interaction Type

Protocol

Protocol Description | Protocol ID | Protocol References | Protocol Remarks | Protocol Type

Provenance

Funding Attribution | Funding Attribution ID | Project ID | Project Title

Resource Relationship

Related Basis of Record | Related Resource ID | Related Resource Type | Relationship According To | Relationship Established Date | Relationship Of Resource | Relationship Of Resource ID | Relationship Remarks | Resource ID | Resource Relationship ID

Taxon

Accepted Name Usage | Accepted Name Usage ID | Accepted Scientific Name | Accepted Scientific Name ID | Accepted Taxon | Accepted Taxon ID | Accepted Taxon ID | Accepted Taxon Name | Accepted Taxon Name ID | Basionym | Basionym ID | Binomial | Class | Cultivar Epithet | Family | Generic Name | Genus | Higher Classification | Higher Taxon | Higher Taxon Concept ID | Higher Taxon ID | Higher Taxon Name | Higher Taxon Name ID | Infrageneric Epithet | Infraspecific Epithet | Kingdom | Name According To | Name According To ID | Name Publication ID | Name Published In | Name Published In ID | Name Published In Year | Nomenclatural Code | Nomenclatural Status | Order | Original Name Usage | Original Name Usage ID | Parent Name Usage | Parent Name Usage ID | Phylum | Scientific Name | Scientific Name Authorship | Scientific Name ID | Scientific Name Rank | Specific Epithet | Subfamily | Subgenus | Subtribe | Superfamily | Taxon According To | Taxon Attributes | Taxon Concept ID | Taxon ID | Taxon ID | Taxon Name ID | Taxon Rank | Taxon Remarks | Taxonomic Status | Tribe | Verbatim Scientific Name Rank | Verbatim Taxon Rank | Vernacular Name

Usage Policy

No properties are currently organized in this class.

IRI-value terms

Assay Type (IRI) | Assertion By (IRI) | Assertion Type (IRI) | Assertion Unit (IRI) | Assertion Value (IRI) | Behavior (IRI) | Caste (IRI) | Data Generalizations (IRI) | Degree of Establishment (IRI) | Discipline (IRI) | Disposition (IRI) | Earliest Geochronological Era | Establishment Means (IRI) | Event Category (IRI) | Event Type (IRI) | Field Notes (IRI) | Field Number (IRI) | Footprint SRS (IRI) | Footprint WKT (IRI) | From Lithostratigraphic Unit | Funding Attribution (IRI) | Geodetic Datum (IRI) | Georeference Protocol (IRI) | Georeference Sources (IRI) | Georeference Verification Status (IRI) | Georeferenced By (IRI) | Habitat (IRI) | Identification Qualifier (IRI) | Identification Type (IRI) | Identification Verification Status (IRI) | Identified By (IRI) | In Collection | In Dataset | In Described Place | Information Withheld (IRI) | Latest Geochronological Era | Life Stage (IRI) | Location According To (IRI) | Material Entity Category (IRI) | Material Entity Type (IRI) | Measurement Determined By (IRI) | Measurement Method (IRI) | Measurement Type (IRI) | Measurement Unit (IRI) | Measurement Value (IRI) | Object Quantity Type (IRI) | Occurrence Status (IRI) | Organism Interaction Type (IRI) | Organism Quantity Type (IRI) | Organism Scope (IRI) | Pathway (IRI) | Preferred Spatial Representation (IRI) | Preparations (IRI) | Protocol Type (IRI) | Record Number (IRI) | Recorded By (IRI) | Reproductive Condition (IRI) | Sampled Substrate Category (IRI) | Sampled Substrate Layer (IRI) | Sampling Protocol (IRI) | Sampling Size Unit (IRI) | Sex (IRI) | Site Number (IRI) | Taxon Formula (IRI) | To Digital Specimen | To Taxon | Type Status (IRI) | Verbatim Coordinate System (IRI) | Verbatim SRS (IRI) | Vertical Datum (IRI) | Vitality (IRI)

4 Vocabulary

Term Name dwc:acceptedNameUsage
Term IRI http://rs.tdwg.org/dwc/terms/acceptedNameUsage
Modified 2025-06-12
Term version IRI http://rs.tdwg.org/dwc/terms/version/acceptedNameUsage-2025-06-12
Label Accepted Name Usage
Definition The full name, with authorship and date information if known, of the currently valid (zoological) or accepted (botanical) dwc:Taxon.
Notes The full scientific name, with authorship and date information if known, of the accepted (botanical) or valid (zoological) name in cases where the provided dwc:scientificName is considered by the reference indicated in the dwc:nameAccordingTo property, or of the content provider, to be a synonym or misapplied name. When applied to a dwc:Organism or dwc:Occurrence, this term should be used in cases where a content provider regards the provided dwc:scientificName to be inconsistent with the taxonomic perspective of the content provider. For example, there are many discrepancies within specimen collections and observation datasets between the recorded name (e.g., the most recent identification from an expert who examined a specimen, or a field identification for an observed dwc:Organism), and the name asserted by the content provider to be taxonomically accepted.
Examples Tamias minimus (valid name for Eutamias minimus)
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-06-12_44
Term Name dwc:acceptedNameUsageID
Term IRI http://rs.tdwg.org/dwc/terms/acceptedNameUsageID
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/acceptedNameUsageID-2023-06-28
Label Accepted Name Usage ID
Definition An identifier for the name usage (documented meaning of the name according to a source) of the currently valid (zoological) or accepted (botanical) taxon.
Notes This term should be used for synonyms or misapplied names to refer to the dwc:taxonID of a dwc:Taxon record that represents the accepted (botanical) or valid (zoological) name. For Darwin Core Archives the related record should be present locally in the same archive.
Examples
  • tsn:41107 (ITIS)
  • urn:lsid:ipni.org:names:320035-2 (IPNI)
  • 2704179 (GBIF)
  • 6W3C4 (COL)
ABCD equivalence not in ABCD
Type Property
Term Name dwc:acceptedScientificName
Term IRI http://rs.tdwg.org/dwc/terms/acceptedScientificName
Modified 2009-09-21
Label Accepted Scientific Name
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/acceptedNameUsage
Definition The currently valid (zoological) or accepted (botanical) name for the scientificName.
Notes Example: "Tamias minimus" valid name for "Eutamias minimus"
ABCD equivalence not in ABCD
Type Property
Term Name dwc:acceptedScientificNameID
Term IRI http://rs.tdwg.org/dwc/terms/acceptedScientificNameID
Modified 2009-08-24
Label Accepted Scientific Name ID
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/acceptedTaxonID
Definition A unique identifier for the acceptedScientificName.
ABCD equivalence not in ABCD
Type Property
Term Name dwc:AcceptedTaxon
Term IRI http://rs.tdwg.org/dwc/terms/AcceptedTaxon
Modified 2009-04-24
Label Accepted Taxon
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/acceptedTaxonName
Definition The currently valid (zoological) or accepted (botanical) name for the ScientificName.
ABCD equivalence not in ABCD
Type Property
Term Name dwc:AcceptedTaxonID
Term IRI http://rs.tdwg.org/dwc/terms/AcceptedTaxonID
Modified 2009-04-24
Label Accepted Taxon ID
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/acceptedTaxonNameID
Definition A global unique identifier for the parent to the AcceptedTaxon.
ABCD equivalence not in ABCD
Type Property
Term Name dwc:acceptedTaxonID
Term IRI http://rs.tdwg.org/dwc/terms/acceptedTaxonID
Modified 2009-09-21
Label Accepted Taxon ID
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/acceptedNameUsageID
Definition An identifier for the name of the currently valid (zoological) or accepted (botanical) taxon. See acceptedTaxon.
Notes Example: "8fa58e08-08de-4ac1-b69c-1235340b7001"
ABCD equivalence not in ABCD
Type Property
Term Name dwc:acceptedTaxonName
Term IRI http://rs.tdwg.org/dwc/terms/acceptedTaxonName
Modified 2009-07-06
Label Accepted Taxon Name
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/acceptedScientificName
Definition The currently valid (zoological) or accepted (botanical) name for the scientificName.
Notes Example: "Tamias minimus" valid name for "Eutamias minimus"
ABCD equivalence not in ABCD
Type Property
Term Name dwc:acceptedTaxonNameID
Term IRI http://rs.tdwg.org/dwc/terms/acceptedTaxonNameID
Modified 2009-07-06
Label Accepted Taxon Name ID
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/acceptedScientificNameID
Definition A unique identifier for the acceptedTaxonName.
ABCD equivalence not in ABCD
Type Property
Term Name dwc:AccessConstraints
Term IRI http://rs.tdwg.org/dwc/terms/AccessConstraints
Modified 2009-09-21
Label Access Constraints
This term is deprecated and should no longer be used.
Is replaced by http://purl.org/dc/terms/accessRights
Definition A description of constraints on the use of the data as shared or access to further data that is not shared.
Notes Example: "not-for-profit use only".
ABCD equivalence DataSets/DataSet/Units/Unit/IPRStatements
Type Property
Term Name dcterms:accessRights
Term IRI http://purl.org/dc/terms/accessRights
Modified 2023-06-28
Term version IRI http://dublincore.org/usage/terms/history/#accessRights-002
Label Access Rights
Definition Information about who can access the resource or an indication of its security status.
Notes Access Rights may include information regarding access or restrictions based on privacy, security, or other policies.
Examples
ABCD equivalence not in ABCD
Type Property
Term Name dwc:accordingTo
Term IRI http://rs.tdwg.org/dwc/terms/accordingTo
Modified 2020-08-06
Label According To
This term is deprecated and should no longer be used.
Definition Abstract term to attribute information to a source.
ABCD equivalence not in ABCD
Type Property
Term Name dwc:accuracy
Term IRI http://rs.tdwg.org/dwc/terms/accuracy
Modified 2009-04-24
Label Accuracy
This term is deprecated and should no longer be used.
Definition Abstract term to capture error information about a measurement or fact.
ABCD equivalence DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Aspect/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Accuracy
Type Property
Term Name dcterms:Agent
Term IRI http://purl.org/dc/terms/Agent
Modified 2026-05-26
Term version IRI http://dublincore.org/usage/terms/history/#Agent-001
Label Agent
Definition A resource that acts or has the power to act.
Notes A person, group, organization, machine, software or other entity that can act. Membership in the dcterms:Agent class is determined by the capacity to act, even if not doing so in a specific context. To act: To participate in an event or process by contributing through behavior, operation, or an effect resulting from active participation — regardless of whether that contribution is intentional, volitional, or conscious.
Examples
  • a person
  • a team of participants on an expedition
  • a funding agency
  • a particular bioacoustic monitoring installation
  • a software instance
  • a particular camera trap
ABCD equivalence not in ABCD
Type Class
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:agentID
Term IRI http://rs.tdwg.org/dwc/terms/agentID
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/agentID-2026-05-26
Label Agent ID
Definition An identifier for a dcterms:Agent.
Notes Recommended best practice is to use a globally unique identifier.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:agentRemarks
Term IRI http://rs.tdwg.org/dwc/terms/agentRemarks
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/agentRemarks-2026-05-26
Label Agent Remarks
Definition Comments or notes about a dcterms:Agent.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:agentRoleOrder
Term IRI http://rs.tdwg.org/dwc/terms/agentRoleOrder
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/agentRoleOrder-2026-05-26
Label Agent Role Order
Definition A numerical position of an AgentRole in a set of AgentRoles.
Notes One could use dwc:agentRoleOrder to create an ordered list of collectors (agentRole = 'collector') for a dwc:MaterialEntity in a Darwin Core Data Package, for example. The first would have dwc:agentRoleOrder=1, the second would have dwc:agentRoleOrder=2.
Examples
  • 1
  • 2
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:agentType
Term IRI http://rs.tdwg.org/dwc/terms/agentType
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/agentType-2026-05-26
Label Agent Type
Definition A category that best matches the nature of a dcterms:Agent.
Notes Recommended best practice is to use a controlled vocabulary.
Examples
  • person
  • group
  • organization
  • camera
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwciri:assayType
Term IRI http://rs.tdwg.org/dwc/iri/assayType
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/iri/version/assayType-2026-05-26
Label Assay Type (IRI)
Definition A type of method used in a study to detect taxon/taxa of interest in a dwc:MaterialEntity.
Notes Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:assayType
Term IRI http://rs.tdwg.org/dwc/terms/assayType
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/assayType-2026-05-26
Label Assay Type
Definition A type of method used in a study to detect taxon/taxa of interest in a dwc:MaterialEntity.
Notes Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples
  • targeted
  • metabarcoding
  • other
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:Assertion
Term IRI http://rs.tdwg.org/dwc/terms/Assertion
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/Assertion-2026-05-26
Label Assertion
Definition A statement about an rdfs:Resource (http://www.w3.org/2000/01/rdf-schema#Resource).
Notes Resources can be thought of as identifiable records or instances of classes and may include, but need not be limited to instances of dwc:Occurrence, dwc:Organism, dwc:MaterialEntity, dwc:Event, dcterms:Location, dwc:GeologicalContext, dwc:Identification, or dwc:Taxon.
Examples
  • the weight of a dwc:Organism in grams
  • the number of placental scars
  • surface water temperature in Celsius
ABCD equivalence Datasets/Dataset/Units/Unit/MeasurementsOrFacts or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts
Type Class
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwciri:assertionBy
Term IRI http://rs.tdwg.org/dwc/iri/assertionBy
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/iri/version/assertionBy-2026-05-26
Label Assertion By (IRI)
Definition An IRI identifying a dcterms:Agent responsible for making a dwc:Assertion.
Notes Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:assertionBy
Term IRI http://rs.tdwg.org/dwc/terms/assertionBy
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/assertionBy-2026-05-26
Label Assertion By
Definition A name for a dcterms:Agent responsible for making a dwc:Assertion.
Notes Recommended best practice is to separate the values in a list with space vertical bar space ( | ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples
  • Rob Guralnick
  • Peter Desmet | Stijn Van Hoey
  • ChatGPT
  • Notes From Nature
  • ROV SuBastian
ABCD equivalence DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/MeasuredBy
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:assertionEffectiveDate
Term IRI http://rs.tdwg.org/dwc/terms/assertionEffectiveDate
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/assertionEffectiveDate-2026-05-26
Label Assertion Effective Date
Definition A date on which a state or measurement of a dwc:Assertion was deemed to first be in effect.
Notes Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples
  • 1963-03-08T14:07-06:00 (8 Mar 1963 at or after 2:07pm and before 2:08pm in the time zone six hours earlier than UTC)
  • 2009-02-20T08:40Z (20 February 2009 at or after 8:40am and before 8:41 UTC)
  • 2018-08-29T15:19 (29 August 2018 at or after 3:19pm and before 3:20pm local time)
  • 1809-02-12 (within the day 12 February 1809)
  • 1906-06 (in the month of June 1906)
  • 1971 (in the year 1971)
  • 2007-03-01T13:00:00Z/2008-05-11T15:30:00Z (some time within the interval beginning 1 March 2007 at 1pm UTC and before 11 May 2008 at 3:30pm UTC)
  • 1900/1909 (some time within the interval between the beginning of the year 1900 and before the year 1909)
  • 2007-11-13/15 (some time in the interval between the beginning of 13 November 2007 and before 15 November 2007)
ABCD equivalence DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/MeasurementDateTime
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:assertionError
Term IRI http://rs.tdwg.org/dwc/terms/assertionError
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/assertionError-2026-05-26
Label Assertion Error
Definition A description of the potential error associated with a dwc:assertionValue.
Examples
  • 0.01
  • normal distribution with variation of 2 m
ABCD equivalence DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Accuracy or DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Aspect/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Accuracy
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:assertionID
Term IRI http://rs.tdwg.org/dwc/terms/assertionID
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/assertionID-2026-05-26
Label Assertion ID
Definition An identifier for a dwc:Assertion.
Notes Recommended best practice is to use a globally unique identifier.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:assertionMadeDate
Term IRI http://rs.tdwg.org/dwc/terms/assertionMadeDate
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/assertionMadeDate-2026-05-26
Label Assertion Made Date
Definition A date on which a dwc:Assertion was created.
Notes Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples
  • 1963-03-08T14:07-06:00 (8 Mar 1963 at or after 2:07pm and before 2:08pm in the time zone six hours earlier than UTC)
  • 2009-02-20T08:40Z (20 February 2009 at or after 8:40am and before 8:41 UTC)
  • 2018-08-29T15:19 (29 August 2018 at or after 3:19pm and before 3:20pm local time)
  • 1809-02-12 (within the day 12 February 1809)
  • 1906-06 (in the month of June 1906)
  • 1971 (in the year 1971)
  • 2007-03-01T13:00:00Z/2008-05-11T15:30:00Z (some time within the interval beginning 1 March 2007 at 1pm UTC and before 11 May 2008 at 3:30pm UTC)
  • 1900/1909 (some time within the interval between the beginning of the year 1900 and before the year 1909)
  • 2007-11-13/15 (some time in the interval between the beginning of 13 November 2007 and before 15 November 2007)
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:assertionProtocols
Term IRI http://rs.tdwg.org/dwc/terms/assertionProtocols
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/assertionProtocols-2026-05-26
Label Assertion Protocols
Definition Names of, references to, or descriptions of dwc:Protocols used in making a dwc:Assertion.
ABCD equivalence /DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Method or /DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/Method or /DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/Method
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:assertionReferences
Term IRI http://rs.tdwg.org/dwc/terms/assertionReferences
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/assertionReferences-2026-05-26
Label Assertion References
Definition A list (concatenated and separated) of dcterms:BibliographicResources associated with a dwc:Assertion.
Notes Recommended best practice is to separate the values in a list with space vertical bar space ( | ).
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:assertionRemarks
Term IRI http://rs.tdwg.org/dwc/terms/assertionRemarks
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/assertionRemarks-2026-05-26
Label Assertion Remarks
Definition Comments or notes about a dwc:Assertion.
Examples
  • tip of tail missing
  • error determined by independently calibrated measurements
  • error provided is from the manufacturer’s standard instrument specification
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwciri:assertionType
Term IRI http://rs.tdwg.org/dwc/iri/assertionType
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/iri/version/assertionType-2026-05-26
Label Assertion Type (IRI)
Definition A category that best matches the nature of a dwc:Assertion.
Notes Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:assertionType
Term IRI http://rs.tdwg.org/dwc/terms/assertionType
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/assertionType-2026-05-26
Label Assertion Type
Definition A category that best matches the nature of a dwc:Assertion.
Notes Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples
  • tailLength
  • waterTemperature
  • trapLineLength
  • surveyArea
  • trapType
ABCD equivalence DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Parameter or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Parameter
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwciri:assertionUnit
Term IRI http://rs.tdwg.org/dwc/iri/assertionUnit
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/iri/version/assertionUnit-2026-05-26
Label Assertion Unit (IRI)
Definition A unit associated with the value in dwc:assertionValue.
Notes Recommended best practice is to use a controlled vocabulary such as the Ontology of Units of Measure http://www.ontology-of-units-of-measure.org for SI units, derived units, or other non-SI units accepted for use within the SI. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:assertionUnit
Term IRI http://rs.tdwg.org/dwc/terms/assertionUnit
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/assertionUnit-2026-05-26
Label Assertion Unit
Definition A unit associated with the value in dwc:assertionValue.
Notes Recommended best practice is to use a controlled vocabulary such as the Ontology of Units of Measure http://www.ontology-of-units-of-measure.org for SI units, derived units, or other non-SI units accepted for use within the SI. For units that are composed of multiple parts, use the patterns as given in "A Primer for Communicating Mathematics via Plain Text" (https://cse.sc.edu/~fenner/latex-ASCII.pdf) by Stephen Fenner (e.g., g/cm^3 for grams per cubic centimeter). For other units, provide the value as a recognizable standard (e.g., '%') or written out in full and in the plural (e.g., individuals). It is fine to provide non-SI units in the original language of the dataset. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples
  • m
  • s
  • g
  • ml
  • %
  • individuals
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UnitOfMeasurement or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UnitOfMeasurement
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:assertionValue
Term IRI http://rs.tdwg.org/dwc/terms/assertionValue
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/assertionValue-2026-05-26
Label Assertion Value
Definition An asserted value.
Notes This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples
  • 45
  • 20
  • 1
  • 14.5
  • UV-light
  • Hamon grab
ABCD equivalence DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/UpperValue
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwciri:assertionValue
Term IRI http://rs.tdwg.org/dwc/iri/assertionValue
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/iri/version/assertionValue-2026-05-26
Label Assertion Value (IRI)
Definition An asserted value.
Notes Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples http://vocab.nerc.ac.uk/collection/L22/current/TOOL0960/
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:associatedMedia
Term IRI http://rs.tdwg.org/dwc/terms/associatedMedia
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/associatedMedia-2023-06-28
Label Associated Media
Definition A list (concatenated and separated) of identifiers (publication, global unique identifier, URI) of media associated with the dwc:Occurrence.
Examples https://arctos.database.museum/media/10520962 | https://arctos.database.museum/media/10520964
ABCD equivalence DataSets/DataSet/Units/Unit/MultimediaObjects
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2014-10-30_16
Term Name dwc:associatedOccurrences
Term IRI http://rs.tdwg.org/dwc/terms/associatedOccurrences
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/associatedOccurrences-2023-06-28
Label Associated Occurrences
Definition A list (concatenated and separated) of identifiers of other dwc:Occurrence records and their associations to this dwc:Occurrence.
Notes This term can be used to provide a list of associations to other dwc:Occurrences. Note that the dwc:ResourceRelationship class is an alternative means of representing associations, and with more detail. Recommended best practice is to separate the values in a list with space vertical bar space ( | ).
Examples
ABCD equivalence DataSets/DataSet/Units/Unit/Associations/UnitAssociation/AssociatedUnitSourceInstitutionCode + DataSets/DataSet/Units/Unit/Associations/UnitAssociation/AssociatedUnitSourceName + DataSets/DataSet/Units/Unit/Associations/UnitAssociation/AssociatedUnitID
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2014-10-26_14
Executive Committee decision http://rs.tdwg.org/decisions/decision-2014-10-30_16
Term Name dwc:associatedOrganisms
Term IRI http://rs.tdwg.org/dwc/terms/associatedOrganisms
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/associatedOrganisms-2023-06-28
Label Associated Organisms
Definition A list (concatenated and separated) of identifiers of other dwc:Organisms and the associations of this dwc:Organism to each of them.
Notes This term can be used to provide a list of associations to other dwc:Organisms. Note that the dwc:ResourceRelationship class is an alternative means of representing associations, and with more detail. Recommended best practice is to separate the values in a list with space vertical bar space ( | ).
Examples
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2014-10-26_14
Term Name dwc:associatedReferences
Term IRI http://rs.tdwg.org/dwc/terms/associatedReferences
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/associatedReferences-2023-06-28
Label Associated References
Definition A list (concatenated and separated) of identifiers (publication, bibliographic reference, global unique identifier, URI) of literature associated with the dwc:Occurrence.
Notes Recommended best practice is to separate the values in a list with space vertical bar space ( | ). Note that the dwc:ResourceRelationship class is an alternative means of representing associations, and with more detail. Note also that the intended usage of the term dcterms:references in Darwin Core when applied to a dwc:Occurrence is to point to the definitive source representation of that dwc:Occurrence if one is available. Note also that the intended usage of dcterms:bibliographicCitation in Darwin Core when applied to a dwc:Occurrence is to provide the preferred way to cite the dwc:Occurrence itself.
Examples
  • http://www.sciencemag.org/cgi/content/abstract/322/5899/261
  • Christopher J. Conroy, Jennifer L. Neuwald. 2008. Phylogeographic study of the California vole, Microtus californicus Journal of Mammalogy, 89(3):755-767.
  • Steven R. Hoofer and Ronald A. Van Den Bussche. 2001. Phylogenetic Relationships of Plecotine Bats and Allies Based on Mitochondrial Ribosomal Sequences. Journal of Mammalogy 82(1):131-137. | Walker, Faith M., Jeffrey T. Foster, Kevin P. Drees, Carol L. Chambers. 2014. Spotted bat (Euderma maculatum) microsatellite discovery using illumina sequencing. Conservation Genetics Resources.
ABCD equivalence DataSets/DataSet/Units/Unit/UnitReferences
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2014-10-30_16
Term Name dwc:associatedSequences
Term IRI http://rs.tdwg.org/dwc/terms/associatedSequences
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/associatedSequences-2026-05-26
Label Associated Sequences
Definition A list (concatenated and separated) of dcterms:BibliographicResources for dwc:NucleotideSequences associated with a dwc:MaterialEntity.
Examples
ABCD equivalence DataSets/DataSet/Units/Unit/Sequences/Sequence/ID-in-Database + constant
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-09-13_41
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:associatedTaxa
Term IRI http://rs.tdwg.org/dwc/terms/associatedTaxa
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/associatedTaxa-2023-06-28
Label Associated Taxa
Definition A list (concatenated and separated) of identifiers or names of dwc:Taxon records and the associations of this dwc:Occurrence to each of them.
Notes This term can be used to provide a list of associations to dwc:Taxon records other than the one defined in the dwc:Occurrence. Note that the dwc:ResourceRelationship class is an alternative means of representing associations, and with more detail. This term is not apt for establishing relationships between dwc:Taxon records, only between specific dwc:Occurrences of a dwc:Organism with other dwc:Taxon records. Recommended best practice is to separate the values in a list with space vertical bar space ( | ).
Examples
  • "host":"Quercus alba"
  • "host":"gbif.org/species/2879737"
  • "parasitoid of":"Cyclocephala signaticollis" | "predator of":"Apis mellifera"
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/Synecology/AssociatedTaxa
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2014-10-30_16
Term Name dwc:basionym
Term IRI http://rs.tdwg.org/dwc/terms/basionym
Modified 2009-09-21
Label Basionym
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/originalNameUsage
Definition The basionym (botany) or basonym (bacteriology) of the scientificName.
Notes Example: "Pinus abies"
ABCD equivalence not in ABCD
Type Property
Term Name dwc:basionymID
Term IRI http://rs.tdwg.org/dwc/terms/basionymID
Modified 2009-09-21
Label Basionym ID
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/originalNameUsageID
Definition A unique identifier for the basionym (botany) or basonym (bacteriology) of the scientificName.
ABCD equivalence not in ABCD
Type Property
Term Name dwc:basisOfRecord
Term IRI http://rs.tdwg.org/dwc/terms/basisOfRecord
Modified 2023-09-13
Term version IRI http://rs.tdwg.org/dwc/terms/version/basisOfRecord-2023-09-13
Label Basis Of Record
Definition The specific nature of the data record.
Notes Recommended best practice is to use a controlled vocabulary such as the set of local names of the identifiers for classes in Darwin Core.
Examples
  • MaterialEntity
  • PreservedSpecimen
  • FossilSpecimen
  • LivingSpecimen
  • MaterialSample
  • Event
  • HumanObservation
  • MachineObservation
  • Taxon
  • Occurrence
  • MaterialCitation
ABCD equivalence DataSets/DataSet/Units/Unit/RecordBasis
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2009-12-07_2
Executive Committee decision http://rs.tdwg.org/decisions/decision-2014-10-26_15
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-06-28_40
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-09-13_41
Term Name dwc:bed
Term IRI http://rs.tdwg.org/dwc/terms/bed
Modified 2023-09-13
Term version IRI http://rs.tdwg.org/dwc/terms/version/bed-2023-09-13
Label Bed
Definition The full name of the lithostratigraphic bed from which the dwc:MaterialEntity was collected.
Examples Harlem coal
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-09-13_41
Executive Committee decision http://rs.tdwg.org/decisions/decision-2024-02-28_43
Term Name dwc:behavior
Term IRI http://rs.tdwg.org/dwc/terms/behavior
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/behavior-2026-05-26
Label Behavior
Definition A behavior shown by a dwc:Organism.
Notes This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples
  • roosting
  • foraging
  • running
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwciri:behavior
Term IRI http://rs.tdwg.org/dwc/iri/behavior
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/iri/version/behavior-2026-05-26
Label Behavior (IRI)
Definition A behavior shown by a dwc:Organism.
Notes Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-07-10_50
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dcterms:bibliographicCitation
Term IRI http://purl.org/dc/terms/bibliographicCitation
Modified 2023-06-28
Term version IRI http://dublincore.org/usage/terms/history/#bibliographicCitation-002
Label Bibliographic Citation
Definition A bibliographic reference for the resource.
Notes From Dublin Core, "Recommended practice is to include sufficient bibliographic detail to identify the resource as unambiguously as possible." The intended usage of this term in Darwin Core is to provide the preferred way to cite the resource itself - "how to cite this record". Note that the intended usage of dcterms:references in Darwin Core, by contrast, is to point to the definitive source representation of the resource - "where to find the as-close-to-original reference", if one is available.
Examples
ABCD equivalence not in ABCD
Type Property
Term Name dcterms:BibliographicResource
Term IRI http://purl.org/dc/terms/BibliographicResource
Modified 2026-05-26
Term version IRI http://dublincore.org/usage/terms/history/#BibliographicResource-001
Label Bibliographic Resource
Definition A book, article, or other documentary resource.
ABCD equivalence not in ABCD
Type Class
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:binomial
Term IRI http://rs.tdwg.org/dwc/terms/binomial
Modified 2009-04-24
Label Binomial
This term is deprecated and should no longer be used.
Definition The combination of genus and first (species) epithet of the scientificName.
Notes Example: "Ctenomys sociabilis"
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/Synecology/AssociatedTaxa/TaxonIdentified/ScientificName/FullScientificNameString
Type Property
Term Name dwciri:caste
Term IRI http://rs.tdwg.org/dwc/iri/caste
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/iri/version/caste-2026-05-26
Label Caste (IRI)
Definition A social caste of a dwc:Organism.
Notes Recommended best practice is to use a controlled vocabulary that aligns best with a dwc:Taxon. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-06-28_40
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-07-10_50
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:caste
Term IRI http://rs.tdwg.org/dwc/terms/caste
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/caste-2026-05-26
Label Caste
Definition A social caste of a dwc:Organism.
Notes Recommended best practice is to use a controlled vocabulary that aligns best with a dwc:Taxon. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples
  • queen
  • male alate
  • intercaste
  • minor worker
  • soldier
  • ergatoid
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-06-28_40
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:catalogNumber
Term IRI http://rs.tdwg.org/dwc/terms/catalogNumber
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/catalogNumber-2026-05-26
Label Catalog Number
Definition An identifier (preferably unique) for a resource within a collection.
Examples
  • 145732
  • 145732a
  • 2008.1334
  • R-4313
ABCD equivalence DataSets/DataSet/Units/Unit/UnitID
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:CatalogNumberNumeric
Term IRI http://rs.tdwg.org/dwc/terms/CatalogNumberNumeric
Modified 2009-04-24
Label Catalog Number Numeric
This term is deprecated and should no longer be used.
Definition The numeric value of the catalogNumber, used to facilitate numerical sorting and searching by ranges.
ABCD equivalence DataSets/DataSet/Units/Unit/UnitIDNumeric
Type Property
Term Name dwc:causeOfDeath
Term IRI http://rs.tdwg.org/dwc/terms/causeOfDeath
Modified 2025-06-12
Term version IRI http://rs.tdwg.org/dwc/terms/version/causeOfDeath-2025-06-12
Label Cause Of Death
Definition An indication of the known or suspected cause of death of a dwc:Organism.
Notes The cause may be due to natural causes (e.g., disease, predation), human-related activities (e.g., roadkill, pollution), or other environmental factors (e.g., extreme weather events).
Examples
  • trap
  • poison
  • starvation
  • drowning
  • shooting
  • old age
  • vehicle collision
  • disease
  • herbicide
  • burning
  • infanticide
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-06-12_44
Term Name dwc:class
Term IRI http://rs.tdwg.org/dwc/terms/class
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/class-2023-06-28
Label Class
Definition The full scientific name of the class in which the dwc:Taxon is classified.
Examples
  • Mammalia
  • Hepaticopsida
ABCD equivalence DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/HigherTaxa/HigherTaxon/HigherTaxonName with HigherTaxa/HigherTaxon/HigherTaxonRank = classis
Type Property
Term Name dwc:collectionCode
Term IRI http://rs.tdwg.org/dwc/terms/collectionCode
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/collectionCode-2026-05-26
Label Collection Code
Definition A name, acronym, coden, or initialism identifying a collection.
Examples
  • Mammals
  • Hildebrandt
  • EBIRD
  • VP
ABCD equivalence DataSets/DataSet/Units/Unit/SourceID
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:collectionID
Term IRI http://rs.tdwg.org/dwc/terms/collectionID
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/collectionID-2026-05-26
Label Collection ID
Definition An identifier for a collection.
Notes For physical specimens, the recommended best practice is to use a globally unique and resolvable identifier from a collections registry such as the Global Registry of Scientific Collections (https://scientific-collections.gbif.org/).
Examples https://scientific-collections.gbif.org/collection/fbd3ed74-5a21-4e01-b86a-33d36f032d9c
ABCD equivalence DataSets/DataSet/Units/Unit/SourceID
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-06-12_44
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:continent
Term IRI http://rs.tdwg.org/dwc/terms/continent
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/continent-2023-06-28
Label Continent
Definition The name of the continent in which the dcterms:Location occurs.
Notes Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names. Recommended best practice is to leave this field blank if the dcterms:Location spans multiple entities at this administrative level or if the dcterms:Location might be in one or another of multiple possible entities at this level. Multiplicity and uncertainty of the geographic entity can be captured either in the term dwc:higherGeography or in the term dwc:locality, or both.
Examples
  • Africa
  • Antarctica
  • Asia
  • Europe
  • North America
  • Oceania
  • South America
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/NamedAreas/NamedArea/AreaName with NamedAreas/NamedArea/AreaClass= Continent
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-06-28_40
Executive Committee decision http://rs.tdwg.org/decisions/decision-2024-02-28_43
Term Name dwc:coordinatePrecision
Term IRI http://rs.tdwg.org/dwc/terms/coordinatePrecision
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/coordinatePrecision-2023-06-28
Label Coordinate Precision
Definition A decimal representation of the precision of the coordinates given in the dwc:decimalLatitude and dwc:decimalLongitude.
Examples
  • 0.00001 (normal GPS limit for decimal degrees)
  • 0.000278 (nearest second)
  • 0.01667 (nearest minute)
  • 1.0 (nearest degree)
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesLatLong/ISOAccuracy or DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesLatLong/AccuracyStatement
Type Property
Term Name dwc:coordinateUncertaintyInMeters
Term IRI http://rs.tdwg.org/dwc/terms/coordinateUncertaintyInMeters
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/coordinateUncertaintyInMeters-2026-05-26
Label Coordinate Uncertainty In Meters
Definition A horizontal distance (in meters) from a given dwc:decimalLatitude and dwc:decimalLongitude describing the smallest circle containing the whole of the dcterms:Location. Zero is not a valid value for this term.
Notes Leave the value empty if the uncertainty is unknown, cannot be estimated, or is not applicable (because there are no coordinates). Zero is not a valid value for this term.
Examples
  • 30 (reasonable lower limit on or after 2000-05-01 of a GPS reading under good conditions if the actual precision was not recorded at the time)
  • 100 (reasonable lower limit before 2000-05-01 of a GPS reading under good conditions if the actual precision was not recorded at the time)
  • 71 (uncertainty for a UTM coordinate having 100 meter precision and a known spatial reference system)
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesLatLon/CoordinateErrorDistanceInMeters
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:country
Term IRI http://rs.tdwg.org/dwc/terms/country
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/country-2023-06-28
Label Country
Definition The name of the country or major administrative unit in which the dcterms:Location occurs.
Notes Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names. Recommended best practice is to leave this field blank if the dcterms:Location spans multiple entities at this administrative level or if the dcterms:Location might be in one or another of multiple possible entities at this level. Multiplicity and uncertainty of the geographic entity can be captured either in the term dwc:higherGeography or in the term dwc:locality, or both.
Examples
  • Denmark
  • Colombia
  • España
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/Country/Name
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2024-02-28_43
Term Name dwc:countryCode
Term IRI http://rs.tdwg.org/dwc/terms/countryCode
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/countryCode-2026-05-26
Label Country Code
Definition The standard code for the country in which the dcterms:Location occurs.
Notes Recommended best practice is to use an ISO 3166-1-alpha-2 country code, or 'ZZ' (for an unknown location or a location unassignable to a single country code), or 'XZ' (for the high seas beyond national jurisdictions). Multiplicity and uncertainty of the geographic entity can be captured either in the term dwc:higherGeography or in the term dwc:locality, or both.
Examples
  • AR
  • SV
  • XZ
  • ZZ
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/Country/ISO3166Code
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-06-28_40
Executive Committee decision http://rs.tdwg.org/decisions/decision-2024-02-28_43
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-06-12_44
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:county
Term IRI http://rs.tdwg.org/dwc/terms/county
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/county-2023-06-28
Label Second Order Division
Definition The full, unabbreviated name of the next smaller administrative region than stateProvince (county, shire, department, etc.) in which the dcterms:Location occurs.
Notes Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names. Recommended best practice is to leave this field blank if the dcterms:Location spans multiple entities at this administrative level or if the dcterms:Location might be in one or another of multiple possible entities at this level. Multiplicity and uncertainty of the geographic entity can be captured either in the term dwc:higherGeography or in the term dwc:locality, or both.
Examples
  • Missoula
  • Los Lagos
  • Mataró
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/NamedAreas/NamedArea/AreaName with NamedAreas/NamedArea/AreaClass= County
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-06-28_40
Executive Committee decision http://rs.tdwg.org/decisions/decision-2024-02-28_43
Term Name dwc:cultivarEpithet
Term IRI http://rs.tdwg.org/dwc/terms/cultivarEpithet
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/cultivarEpithet-2026-05-26
Label Cultivar Epithet
Definition Part of the name of a cultivar, cultivar group or grex that follows the dwc:scientificName.
Notes According to the Rules of the Cultivated Plant Code, a cultivar name consists of a botanical name followed by a cultivar epithet. The value given as the dwc:cultivarEpithet should exclude any quotes. The term dwc:taxonRank should be used to indicate which type of cultivated plant name (e.g., cultivar, cultivar group, grex) is concerned. This epithet, including any enclosing apostrophes or suffix, should be provided in dwc:scientificName as well.
Examples
  • King Edward (for scientificName Solanum tuberosum 'King Edward' and taxonRank cultivar)
  • Mishmiense (for scientificName Rhododendron boothii Mishmiense Group and taxonRank cultivar group)
  • Atlantis (for scientificName Paphiopedilum Atlantis grex and taxonRank grex)
ABCD equivalence http://rs.tdwg.org/abcd/terms/cultivarName or http://rs.tdwg.org/abcd/terms/cultivarGroupName or http://rs.tdwg.org/abcd/terms/breed (ABCD 3.0)
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2021-07-15_34
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-12-11_54
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:dataGeneralizations
Term IRI http://rs.tdwg.org/dwc/terms/dataGeneralizations
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/dataGeneralizations-2023-06-28
Label Data Generalizations
Definition Actions taken to make the shared data less specific or complete than in its original form. Suggests that alternative data of higher quality may be available on request.
Notes This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples Coordinates generalized from original GPS coordinates to the nearest half degree grid cell.
ABCD equivalence not in ABCD
Type Property
Term Name dwciri:dataGeneralizations
Term IRI http://rs.tdwg.org/dwc/iri/dataGeneralizations
Modified 2025-07-10
Term version IRI http://rs.tdwg.org/dwc/iri/version/dataGeneralizations-2025-07-10
Label Data Generalizations (IRI)
Definition Actions taken to make the shared data less specific or complete than in its original form. Suggests that alternative data of higher quality may be available on request.
Notes Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-07-10_50
Term Name dwc:Dataset
Term IRI http://rs.tdwg.org/dwc/terms/Dataset
Modified 2009-09-11
Label Dataset
This term is deprecated and should no longer be used.
Definition The category of information pertaining to a logical set of records.
ABCD equivalence DataSets/DataSet
Type Class
Term Name dwc:datasetID
Term IRI http://rs.tdwg.org/dwc/terms/datasetID
Modified 2017-10-06
Term version IRI http://rs.tdwg.org/dwc/terms/version/datasetID-2017-10-06
Label Dataset ID
Definition An identifier for the set of data. May be a global unique identifier or an identifier specific to a collection or institution.
Examples b15d4952-7d20-46f1-8a3e-556a512b04c5
ABCD equivalence DataSets/DataSet/DataSetGUID
Type Property
Term Name dwc:datasetName
Term IRI http://rs.tdwg.org/dwc/terms/datasetName
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/datasetName-2026-05-26
Label Dataset Name
Definition A name of a source dataset.
Examples
  • Grinnell Resurvey Mammals
  • Lacey Ctenomys Recaptures
ABCD equivalence DataSets/DataSet/Units/Unit/SourceID
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:dateIdentified
Term IRI http://rs.tdwg.org/dwc/terms/dateIdentified
Modified 2025-06-12
Term version IRI http://rs.tdwg.org/dwc/terms/version/dateIdentified-2025-06-12
Label Date Identified
Definition The date on which the subject was determined as representing the dwc:Taxon.
Notes Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples
  • 1963-03-08T14:07-06:00 (8 Mar 1963 at or after 2:07pm and before 2:08pm in the time zone six hours earlier than UTC)
  • 2009-02-20T08:40Z (20 February 2009 at or after 8:40am and before 8:41 UTC)
  • 2018-08-29T15:19 (29 August 2018 at or after 3:19pm and before 3:20pm local time)
  • 1809-02-12 (within the day 12 February 1809)
  • 1906-06 (in the month of June 1906)
  • 1971 (in the year 1971)
  • 2007-03-01T13:00:00Z/2008-05-11T15:30:00Z (some time within the interval beginning 1 March 2007 at 1pm UTC and before 11 May 2008 at 3:30pm UTC)
  • 1900/1909 (some time within the interval between the beginning of the year 1900 and before the year 1909)
  • 2007-11-13/15 (some time in the interval between the beginning of 13 November 2007 and before 15 November 2007)
ABCD equivalence DataSets/DataSet/Units/Unit/Identifications/Identification/Date/DateText
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2019-12-01_19
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-06-12_44
Term Name dwc:day
Term IRI http://rs.tdwg.org/dwc/terms/day
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/day-2023-06-28
Label Day
Definition The integer day of the month on which the dwc:Event occurred.
Examples
  • 9
  • 28
ABCD equivalence accessible from DataSets/DataSet/Units/Unit/Gathering/ISODateTimeBegin
Type Property
Term Name dwc:decimalLatitude
Term IRI http://rs.tdwg.org/dwc/terms/decimalLatitude
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/decimalLatitude-2026-05-26
Label Decimal Latitude
Definition A geographic latitude (in decimal degrees, using the spatial reference system given in dwc:geodeticDatum) of a dcterms:Location.
Notes Positive values are north of the Equator, negative values are south of it. Valid values lie between -90 and 90, inclusive.
Examples -41.0983423
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesLatLon/LatitudeDecimal
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:decimalLongitude
Term IRI http://rs.tdwg.org/dwc/terms/decimalLongitude
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/decimalLongitude-2026-05-26
Label Decimal Longitude
Definition A geographic longitude (in decimal degrees, using the spatial reference system given in dwc:geodeticDatum) of a dcterms:Location.
Notes Positive values are east of the Greenwich Meridian, negative values are west of it. Valid values lie between -180 and 180, inclusive.
Examples -121.1761111
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesLatLon/LongitudeDecimal
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:degreeOfEstablishment
Term IRI http://rs.tdwg.org/dwc/terms/degreeOfEstablishment
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/degreeOfEstablishment-2023-06-28
Label Degree of Establishment
Definition The degree to which a dwc:Organism survives, reproduces, and expands its range at the given place and time.
Notes Recommended best practice is to use controlled value strings from the controlled vocabulary designated for use with this term, listed at http://rs.tdwg.org/dwc/doc/doe/. For details, refer to https://doi.org/10.3897/biss.3.38084. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples
  • native
  • captive
  • cultivated
  • released
  • failing
  • casual
  • reproducing
  • established
  • colonising
  • invasive
  • widespreadInvasive
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2020-10-13_27
Executive Committee decision http://rs.tdwg.org/decisions/decision-2024-02-28_43
Term Name dwciri:degreeOfEstablishment
Term IRI http://rs.tdwg.org/dwc/iri/degreeOfEstablishment
Modified 2025-07-10
Term version IRI http://rs.tdwg.org/dwc/iri/version/degreeOfEstablishment-2025-07-10
Label Degree of Establishment (IRI)
Definition The degree to which a dwc:Organism survives, reproduces, and expands its range at the given place and time.
Notes Recommended best practice is to use IRIs from the controlled vocabulary designated for use with this term, listed at http://rs.tdwg.org/dwc/doc/doe/. For details, refer to https://doi.org/10.3897/biss.3.38084 . Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2020-10-13_27
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-07-10_50
Term Name dwc:digitalSpecimenID
Term IRI http://rs.tdwg.org/dwc/terms/digitalSpecimenID
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/digitalSpecimenID-2026-05-26
Label Digital Specimen ID
Definition An identifier for a Digital Specimen resource.
Notes A Digital Specimen is defined in https://doi.org/10.3897/rio.7.e67379. A dwc:digitalSpecimenID is intended to uniquely and persistently identify a Digital Specimen. Recommended best practice is to use a DOI with machine readable metadata in the DOI record that uses a community agreed metadata profile (also known as FDO profile) for a Digital Specimen. For an example see: https://doi.org/10.3535/N75-CR4-0SM?noredirect. The identifier is for a digital information artifact (the Digital Specimen) as opposed to an identifier for a specific instance of a dwc:MaterialEntity.
Examples
ABCD equivalence Note: /DataSets/DataSet/Units/Unit/UnitGUID could be used. A new term /DataSets/DataSet/Units/Unit/SpecimenUnit/digitalSpecimenID would make it distinguishable from URIs that identify the physical object or catalogue record.
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-06-12_44
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwciri:discipline
Term IRI http://rs.tdwg.org/dwc/iri/discipline
Modified 2025-06-12
Term version IRI http://rs.tdwg.org/dwc/iri/version/discipline-2025-06-12
Label Discipline (IRI)
Definition The primary branch or branches of knowledge represented by the record.
Notes This term can be used to classify records according to branches of knowledge. Recommended best practice is to use a controlled vocabulary. Terms in the dwciri namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-06-12_44
Term Name dwc:discipline
Term IRI http://rs.tdwg.org/dwc/terms/discipline
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/discipline-2026-05-26
Label Discipline
Definition The primary branch or branches of knowledge represented by a dwc:MaterialEntity.
Notes This term can be used to classify records according to branches of knowledge. Recommended best practice is to use a controlled vocabulary and to separate the values in a list with space vertical bar space ( | ). It is also recommended to use this field to describe specimenType in MIDS. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples
  • Botany
  • Botany | Virology | Taxonomy
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-06-12_44
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwciri:disposition
Term IRI http://rs.tdwg.org/dwc/iri/disposition
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/iri/version/disposition-2026-05-26
Label Disposition (IRI)
Definition A current state of a dwc:MaterialEntity with respect to where it can be found.
Notes Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-07-10_50
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:disposition
Term IRI http://rs.tdwg.org/dwc/terms/disposition
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/disposition-2026-05-26
Label Disposition
Definition A current state of a dwc:MaterialEntity with respect to where it can be found.
Notes Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples
  • in collection
  • missing
  • on loan
  • used up
  • destroyed
  • deaccessioned
ABCD equivalence DataSets/DataSet/Units/Unit/SpecimenUnit/Disposition
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-09-13_41
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:DwCType
Term IRI http://rs.tdwg.org/dwc/terms/DwCType
Modified 2014-10-23
Label Darwin Core Type
This term is deprecated and should no longer be used.
Definition The set of classes specified by the Darwin Core Type Vocabulary, used to categorize the nature or genre of the resource.
ABCD equivalence not in ABCD
Type http://purl.org/dc/dcam/VocabularyEncodingScheme
Term Name dwc:dynamicProperties
Term IRI http://rs.tdwg.org/dwc/terms/dynamicProperties
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/dynamicProperties-2023-06-28
Label Dynamic Properties
Definition A list of additional measurements, facts, characteristics, or assertions about the record. Meant to provide a mechanism for structured content.
Notes Recommended best practice is to use a key:value encoding schema for a data interchange format such as JSON.
Examples
  • {"heightInMeters":1.5}
  • {"targusLengthInMeters":0.014, "weightInGrams":120}
  • {"natureOfID":"expert identification", "identificationEvidence":"cytochrome B sequence"}
  • {"relativeHumidity":28, "airTemperatureInCelsius":22, "sampleSizeInKilograms":10}
  • {"aspectHeading":277, "slopeInDegrees":6}
  • {"iucnStatus":"vulnerable", "taxonDistribution":"Neuquén, Argentina"}
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2014-10-30_16
Term Name dwc:earliestAgeOrLowestStage
Term IRI http://rs.tdwg.org/dwc/terms/earliestAgeOrLowestStage
Modified 2023-09-13
Term version IRI http://rs.tdwg.org/dwc/terms/version/earliestAgeOrLowestStage-2023-09-13
Label Earliest Age Or Lowest Stage
Definition The full name of the earliest possible geochronologic age or lowest chronostratigraphic stage attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected.
Examples
  • Atlantic
  • Boreal
  • Skullrockian
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-09-13_41
Executive Committee decision http://rs.tdwg.org/decisions/decision-2024-02-28_43
Term Name dwc:EarliestDateCollected
Term IRI http://rs.tdwg.org/dwc/terms/EarliestDateCollected
Modified 2009-04-24
Label Earliest Date Collected
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/eventDate
Definition The earliest date-time in a period during which a event occurred. If the event is recorded as occurring at a single date-time, populate both EarliestDateCollected and LatestDateCollected with the same value. Recommended best practice is to use an encoding scheme, such as ISO 8601:2004(E).
Notes Date may be used to express temporal information at any level of granularity. Recommended best practice is to use an encoding scheme, such as the W3CDTF profile of ISO 8601 [W3CDTF].
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/ISODateTimeBegin
Type Property
Term Name dwc:earliestEonOrLowestEonothem
Term IRI http://rs.tdwg.org/dwc/terms/earliestEonOrLowestEonothem
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/earliestEonOrLowestEonothem-2026-05-26
Label Earliest Eon Or Lowest Eonothem
Definition The full name of the earliest possible geochronologic eon or lowest chronostratigraphic eonothem or the informal name attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected.
Examples
  • Phanerozoic
  • Proterozoic
  • Precambrian
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-09-13_41
Executive Committee decision http://rs.tdwg.org/decisions/decision-2024-02-28_43
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:earliestEpochOrLowestSeries
Term IRI http://rs.tdwg.org/dwc/terms/earliestEpochOrLowestSeries
Modified 2023-09-13
Term version IRI http://rs.tdwg.org/dwc/terms/version/earliestEpochOrLowestSeries-2023-09-13
Label Earliest Epoch Or Lowest Series
Definition The full name of the earliest possible geochronologic epoch or lowest chronostratigraphic series attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected.
Examples
  • Holocene
  • Pleistocene
  • Ibexian Series
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-09-13_41
Executive Committee decision http://rs.tdwg.org/decisions/decision-2024-02-28_43
Term Name dwc:earliestEraOrLowestErathem
Term IRI http://rs.tdwg.org/dwc/terms/earliestEraOrLowestErathem
Modified 2023-09-13
Term version IRI http://rs.tdwg.org/dwc/terms/version/earliestEraOrLowestErathem-2023-09-13
Label Earliest Era Or Lowest Erathem
Definition The full name of the earliest possible geochronologic era or lowest chronostratigraphic erathem attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected.
Examples
  • Cenozoic
  • Mesozoic
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-09-13_41
Executive Committee decision http://rs.tdwg.org/decisions/decision-2024-02-28_43
Term Name dwciri:earliestGeochronologicalEra
Term IRI http://rs.tdwg.org/dwc/iri/earliestGeochronologicalEra
Modified 2023-09-13
Term version IRI http://rs.tdwg.org/dwc/iri/version/earliestGeochronologicalEra-2023-09-13
Label Earliest Geochronological Era
Definition Use to link a dwc:GeologicalContext instance to chronostratigraphic time periods at the lowest possible level in a standardized hierarchy. Use this property to point to the earliest possible geological time period from which the dwc:MaterialEntity was collected.
Notes Recommended best practice is to use an IRI from a controlled vocabulary. A "convenience property" that replaces Darwin Core literal-value terms related to geological context. See Section 2.7.6 of the Darwin Core RDF Guide for details.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-09-13_41
Term Name dwc:earliestPeriodOrLowestSystem
Term IRI http://rs.tdwg.org/dwc/terms/earliestPeriodOrLowestSystem
Modified 2023-09-13
Term version IRI http://rs.tdwg.org/dwc/terms/version/earliestPeriodOrLowestSystem-2023-09-13
Label Earliest Period Or Lowest System
Definition The full name of the earliest possible geochronologic period or lowest chronostratigraphic system attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected.
Examples
  • Neogene
  • Tertiary
  • Quaternary
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-09-13_41
Executive Committee decision http://rs.tdwg.org/decisions/decision-2024-02-28_43
Term Name dwc:endDayOfYear
Term IRI http://rs.tdwg.org/dwc/terms/endDayOfYear
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/endDayOfYear-2026-05-26
Label End Day Of Year
Definition The latest integer day of the year on which a dwc:Event occurred.
Notes The value is 1 for January 1 and 365 for December 31, except in a leap year, in which case it is 366.
Examples
  • 1 (1 January)
  • 32 (1 February)
  • 366 (31 December)
  • 365 (30 December in a leap year, 31 December in a non-leap year)
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/DateTime/DayNumberEnd
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:EndTimeOfDay
Term IRI http://rs.tdwg.org/dwc/terms/EndTimeOfDay
Modified 2009-04-24
Label End Time of Day
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/eventTime
Definition The time of day when the event ended, expressed as decimal hours from midnight, local time.
Notes Examples: "12.0" (= noon), "13.5" (= 1:30pm)
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/DateTime/TimeOfDayEnd
Type Property
Term Name dwciri:establishmentMeans
Term IRI http://rs.tdwg.org/dwc/iri/establishmentMeans
Modified 2025-07-10
Term version IRI http://rs.tdwg.org/dwc/iri/version/establishmentMeans-2025-07-10
Label Establishment Means (IRI)
Definition Statement about whether a dwc:Organism has been introduced to a given place and time through the direct or indirect activity of modern humans.
Notes Recommended best practice is to use IRIs from the controlled vocabulary designated for use with this term, listed at http://rs.tdwg.org/dwc/doc/em/. For details, refer to https://doi.org/10.3897/biss.3.38084 . Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2020-10-13_25
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-07-10_50
Term Name dwc:establishmentMeans
Term IRI http://rs.tdwg.org/dwc/terms/establishmentMeans
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/establishmentMeans-2026-05-26
Label Establishment Means
Definition Statement about whether a dwc:Organism has been introduced to a given place and time through the direct or indirect activity of modern humans.
Notes Recommended best practice is to use controlled value strings from the controlled vocabulary designated for use with this term, listed at http://rs.tdwg.org/dwc/doc/em/. For details, refer to https://doi.org/10.3897/biss.3.38084. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples
  • native
  • nativeEndemic
  • nativeReintroduced
  • introduced
  • introducedAssistedColonisation
  • vagrant
  • uncertain
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/EstablishmentMeans
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2020-10-13_25
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:Event
Term IRI http://rs.tdwg.org/dwc/terms/Event
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/Event-2026-05-26
Label Event
Definition An action, process, or set of circumstances occurring at a dcterms:Location during a period of time.
Examples
  • a material collecting event
  • a bird observation
  • a camera trap image capture
  • an organism occurrence
  • a biotic survey
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering
Type Class
Executive Committee decision http://rs.tdwg.org/decisions/decision-2014-10-26_15
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:EventAttribute
Term IRI http://rs.tdwg.org/dwc/terms/EventAttribute
Modified 2009-04-24
Label Event Attribute
This term is deprecated and should no longer be used.
Definition Container class for information about attributes related to a given sampling event.
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts
Type Class
Term Name dwc:EventAttributeAccuracy
Term IRI http://rs.tdwg.org/dwc/terms/EventAttributeAccuracy
Modified 2009-04-24
Label Event Attribute Accuracy
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/eventMeasurementAccuracy
Definition The description of the error associated with the EventAttributeValue.
Notes Example: "0.01", "normal distribution with variation of 2 m"
ABCD equivalence DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Aspect/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Accuracy
Type Property
Term Name dwc:EventAttributeDeterminedBy
Term IRI http://rs.tdwg.org/dwc/terms/EventAttributeDeterminedBy
Modified 2009-04-24
Label Event Attribute Determined By
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/eventMeasurementDeterminedBy
Definition The agent responsible for having determined the value of the measurement or characteristic of the sampling event.
Notes Example: "Robert Hijmans"
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/MeasuredBy
Type Property
Term Name dwc:EventAttributeDeterminedDate
Term IRI http://rs.tdwg.org/dwc/terms/EventAttributeDeterminedDate
Modified 2009-04-24
Label Event Attribute Determined Date
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/eventMeasurementDeterminedDate
Definition The date on which the the measurement or characteristic of the sampling event was made.
Notes Date may be used to express temporal information at any level of granularity. Recommended best practice is to use an encoding scheme, such as the W3CDTF profile of ISO 8601 [W3CDTF].
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/MeasurementDateTime
Type Property
Term Name dwc:EventAttributeID
Term IRI http://rs.tdwg.org/dwc/terms/EventAttributeID
Modified 2009-04-24
Label Event Attribute ID
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/eventMeasurementID
Definition An identifier for the event attribute. May be a global unique identifier or an identifier specific to the data set.
ABCD equivalence not in ABCD
Type Property
Term Name dwc:EventAttributeRemarks
Term IRI http://rs.tdwg.org/dwc/terms/EventAttributeRemarks
Modified 2009-04-24
Label Event Attribute Remarks
This term is deprecated and should no longer be used.
Definition Comments or notes accompanying the measurement or characteristic of the sampling event.
Notes Example: "temperature taken at 15:00"
ABCD equivalence not in ABCD
Type Property
Term Name dwc:eventAttributes
Term IRI http://rs.tdwg.org/dwc/terms/eventAttributes
Modified 2009-10-09
Label Event Attributes
This term is deprecated and should no longer be used.
Definition A list (concatenated and separated) of additional measurements or characteristics of the Event.
Notes Example: "Relative humidity: 28 %; Temperature: 22 C; Sample size: 10 kg"
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts
Type Property
Term Name dwc:EventAttributeType
Term IRI http://rs.tdwg.org/dwc/terms/EventAttributeType
Modified 2009-04-24
Label Event Attribute Type
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/eventMeasurementType
Is replaced by http://rs.tdwg.org/dwc/terms/SamplingAttributeType
Definition The nature of the measurement or characteristic of the sampling event. Recommended best practice is to use a controlled vocabulary.
Notes Example: "Temperature"
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Parameter
Type Property
Term Name dwc:EventAttributeUnit
Term IRI http://rs.tdwg.org/dwc/terms/EventAttributeUnit
Modified 2009-04-24
Label Event Attribute Unit
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/eventMeasurementUnit
Definition The units for the value of the measurement or characteristic of the sampling event. Recommended best practice is to use International System of Units (SI) units.
Notes Example: "C"
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UnitOfMeasurement
Type Property
Term Name dwc:EventAttributeValue
Term IRI http://rs.tdwg.org/dwc/terms/EventAttributeValue
Modified 2009-04-24
Label Event Attribute
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/eventMeasurementValue
Definition The value of the measurement or characteristic of the sampling event.
Notes Example: "22"
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/UpperValue
Type Property
Term Name dwciri:eventCategory
Term IRI http://rs.tdwg.org/dwc/iri/eventCategory
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/iri/version/eventCategory-2026-05-26
Label Event Category (IRI)
Definition A broad category that best matches the nature of a dwc:Event.
Notes Recommended best practice is to use a limited, tightly controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:eventCategory
Term IRI http://rs.tdwg.org/dwc/terms/eventCategory
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/eventCategory-2026-05-26
Label Event Category
Definition A broad category that best matches the nature of a dwc:Event.
Notes Recommended best practice is to use a limited, tightly controlled vocabulary. Recommended best practice is to use one of the following controlled values: Event, MaterialGathering, Occurrence, OrganismInteraction, or Survey. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples
  • Event
  • MaterialGathering
  • Occurrence
  • OrganismInteraction
  • Survey
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:eventDate
Term IRI http://rs.tdwg.org/dwc/terms/eventDate
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/eventDate-2026-05-26
Label Event Date
Definition A date-time or time interval during which a dwc:Event occurred.
Notes Recommended best practice is to use a date that conforms to ISO 8601-1:2019. Not suitable for a time in a geological context.
Examples
  • 1963-03-08T14:07-06:00 (8 Mar 1963 at or after 2:07pm and before 2:08pm in the time zone six hours earlier than UTC)
  • 2009-02-20T08:40Z (20 February 2009 at or after 8:40am and before 8:41 UTC)
  • 2018-08-29T15:19 (29 August 2018 at or after 3:19pm and before 3:20pm local time)
  • 1809-02-12 (within the day 12 February 1809)
  • 1906-06 (in the month of June 1906)
  • 1971 (in the year 1971)
  • 2007-03-01T13:00:00Z/2008-05-11T15:30:00Z (some time within the interval beginning 1 March 2007 at 1pm UTC and before 11 May 2008 at 3:30pm UTC)
  • 1900/1909 (some time within the interval between the beginning of the year 1900 and before the year 1909)
  • 2007-11-13/15 (some time in the interval between the beginning of 13 November 2007 and before 15 November 2007)
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/ISODateTimeBegin and DataSets/DataSet/Units/Unit/Gathering/ISODateTimeEnd
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-06-12_44
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:eventID
Term IRI http://rs.tdwg.org/dwc/terms/eventID
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/eventID-2023-06-28
Label Event ID
Definition An identifier for the set of information associated with a dwc:Event (something that occurs at a place and time). May be a global unique identifier or an identifier specific to the data set.
Examples INBO:VIS:Ev:00009375
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/Code
Type Property
Term Name dwc:EventMeasurement
Term IRI http://rs.tdwg.org/dwc/terms/EventMeasurement
Modified 2009-10-09
Label Event Measurement
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/MeasurementOrFact
Definition The category of information pertaining to measurements associated with an event.
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts
Type Class
Term Name dwc:eventMeasurementAccuracy
Term IRI http://rs.tdwg.org/dwc/terms/eventMeasurementAccuracy
Modified 2009-10-09
Label Event Measurement Accuracy
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/measurementAccuracy
Definition The description of the error associated with the EventAttributeValue.
Notes Example: "0.01", "normal distribution with variation of 2 m"
ABCD equivalence DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Aspect/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Accuracy
Type Property
Term Name dwc:eventMeasurementDeterminedBy
Term IRI http://rs.tdwg.org/dwc/terms/eventMeasurementDeterminedBy
Modified 2009-10-09
Label Event Measurement Determined By
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/measurementDeterminedBy
Definition The agent responsible for having determined the value of the measurement or characteristic of the event.
Notes Example: "Robert Hijmans"
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/MeasuredBy
Type Property
Term Name dwc:eventMeasurementDeterminedDate
Term IRI http://rs.tdwg.org/dwc/terms/eventMeasurementDeterminedDate
Modified 2009-10-09
Label Event Measurement Determined Date
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/measurementDeterminedDate
Definition The date on which the the measurement or characteristic of the event was made. Recommended best practice is to use an encoding scheme, such as ISO 8601:2004(E).
Notes Examples: "1963-03-08T14:07-0600" is 8 Mar 1963 2:07pm in the time zone six hours earlier than UTC, "2009-02-20T08:40Z" is 20 Feb 2009 8:40am UTC, "1809-02-12" is 12 Feb 1809, "1906-06" is Jun 1906, "1971" is just that year, "2007-03-01T13:00:00Z/2008-05-11T15:30:00Z" is the interval between 1 Mar 2007 1pm UTC and 11 May 2008 3:30pm UTC, "2007-11-13/15" is the interval between 13 Nov 2007 and 15 Nov 2007.
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/MeasurementDateTime
Type Property
Term Name dwc:eventMeasurementID
Term IRI http://rs.tdwg.org/dwc/terms/eventMeasurementID
Modified 2009-10-09
Label Event Measurement ID
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/measurementID
Definition An identifier for the event attribute. May be a global unique identifier or an identifier specific to the data set.
ABCD equivalence not in ABCD
Type Property
Term Name dwc:eventMeasurementRemarks
Term IRI http://rs.tdwg.org/dwc/terms/eventMeasurementRemarks
Modified 2009-10-09
Label Event Measurement Remarks
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/measurementRemarks
Definition Comments or notes accompanying the measurement or characteristic of the event.
Notes Example: "temperature taken at 15:00"
ABCD equivalence not in ABCD
Type Property
Term Name dwc:eventMeasurementType
Term IRI http://rs.tdwg.org/dwc/terms/eventMeasurementType
Modified 2009-10-09
Label Event Measurement Type
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/measurementType
Definition The nature of the measurement or characteristic of the event. Recommended best practice is to use a controlled vocabulary.
Notes Example: "temperature"
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Parameter
Type Property
Term Name dwc:eventMeasurementUnit
Term IRI http://rs.tdwg.org/dwc/terms/eventMeasurementUnit
Modified 2009-10-09
Label Event Measurement Unit
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/measurementUnit
Definition The units for the value of the measurement or characteristic of the event. Recommended best practice is to use International System of Units (SI) units.
Notes Example: "C"
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UnitOfMeasurement
Type Property
Term Name dwc:eventMeasurementValue
Term IRI http://rs.tdwg.org/dwc/terms/eventMeasurementValue
Modified 2009-10-09
Label Event Measurement Value
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/measurementValue
Definition The value of the measurement or characteristic of the event.
Notes Example: "22"
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/UpperValue
Type Property
Term Name dwc:eventRemarks
Term IRI http://rs.tdwg.org/dwc/terms/eventRemarks
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/eventRemarks-2023-06-28
Label Event Remarks
Definition Comments or notes about the dwc:Event.
Examples After the recent rains the river is nearly at flood stage.
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/Notes
Type Property
Term Name dwc:eventTime
Term IRI http://rs.tdwg.org/dwc/terms/eventTime
Modified 2025-06-12
Term version IRI http://rs.tdwg.org/dwc/terms/version/eventTime-2025-06-12
Label Event Time
Definition The time or interval during which a dwc:Event occurred.
Notes Recommended best practice is to use a time of day that conforms to ISO 8601-1:2019.
Examples
  • 14:07-06:00 (at or after 2:07pm and before 2:08pm in the time zone six hours earlier than UTC)
  • 08:40:21Z (at or after 8:40:21am and before 8:41:22am UTC)
  • 13:00:00Z/15:30:00Z (at or after 1pm and before 3:30pm UTC)
ABCD equivalence accessible from DataSets/DataSet/Units/Unit/Gathering/ISODateTimeBegin and DataSets/DataSet/Units/Unit/Gathering/ISODateTimeEnd
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-06-28_40
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-06-12_44
Term Name dwciri:eventType
Term IRI http://rs.tdwg.org/dwc/iri/eventType
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/iri/version/eventType-2026-05-26
Label Event Type (IRI)
Definition A narrow category that best matches the nature of a dwc:Event.
Notes Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-06-28_40
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-07-10_50
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:eventType
Term IRI http://rs.tdwg.org/dwc/terms/eventType
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/eventType-2026-05-26
Label Event Type
Definition A narrow category that best matches the nature of a dwc:Event.
Notes Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples
  • bioBlitz
  • cameraTrapDeployment
  • expedition
  • project
  • siteVisit
  • trawl
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-06-28_40
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:family
Term IRI http://rs.tdwg.org/dwc/terms/family
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/family-2023-06-28
Label Family
Definition The full scientific name of the family in which the dwc:Taxon is classified.
Examples
  • Felidae
  • Monocleaceae
ABCD equivalence DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/HigherTaxa/HigherTaxon/HigherTaxonName with HigherTaxa/HigherTaxon/HigherTaxonRank = familia
Type Property
Term Name dwc:feedbackURL
Term IRI http://rs.tdwg.org/dwc/terms/feedbackURL
Modified 2025-06-12
Term version IRI http://rs.tdwg.org/dwc/terms/version/feedbackURL-2025-06-12
Label Feedback URL
Definition A uniform resource locator (URL) that points to a webpage on which a form may be submitted to gather feedback about the record.
Notes Recommended best practice is to optionally include query strings that act to pre-populate web page form elements and communicate the context.
Examples https://example.com/new?title=New+issue&body=This+comment+is+about+CAN12345
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-06-12_44
Term Name dwciri:fieldNotes
Term IRI http://rs.tdwg.org/dwc/iri/fieldNotes
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/iri/version/fieldNotes-2023-06-28
Label Field Notes (IRI)
Definition One of a) an indicator of the existence of, b) a reference to (publication, URI), or c) the text of notes taken in the field about the dwc:Event.
Notes The subject is a dwc:Event instance and the object is a (possibly IRI-identified) resource that is the field notes.
ABCD equivalence not in ABCD
Type Property
Term Name dwc:fieldNotes
Term IRI http://rs.tdwg.org/dwc/terms/fieldNotes
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/fieldNotes-2023-06-28
Label Field Notes
Definition One of a) an indicator of the existence of, b) a reference to (publication, URI), or c) the text of notes taken in the field about the dwc:Event.
Notes This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples Notes available in the Grinnell-Miller Library.
ABCD equivalence DataSets/DataSet/Units/Unit/FieldNotes
Type Property
Term Name dwc:fieldNumber
Term IRI http://rs.tdwg.org/dwc/terms/fieldNumber
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/fieldNumber-2026-05-26
Label Field Number
Definition An identifier given to a dwc:Event in the field.
Notes Often serves as a link between field notes and a dwc:Event. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples RV Sol 87-03-08
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/Code
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwciri:fieldNumber
Term IRI http://rs.tdwg.org/dwc/iri/fieldNumber
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/iri/version/fieldNumber-2026-05-26
Label Field Number (IRI)
Definition An identifier given to a dwc:Event in the field.
Notes Often serves as a link between field notes and a dwc:Event. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:footprintSpatialFit
Term IRI http://rs.tdwg.org/dwc/terms/footprintSpatialFit
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/footprintSpatialFit-2026-05-26
Label Footprint Spatial Fit
Definition A ratio of the area of a footprint (dwc:footprintWKT) to the area of a true (original, or most specific) spatial representation of a dcterms:Location.
Notes Legal values are 0, greater than or equal to 1, or undefined. A value of 1 is an exact match or 100% overlap. A value of 0 should be used if the given footprint does not completely contain the original representation. A dwc:footprintSpatialFit is undefined (and should be left empty) if the original representation is any geometry without area (e.g., a point or polyline) and without uncertainty and the given georeference is not that same geometry (without uncertainty). If both the original and the given georeference are the same point, a dwc:footprintSpatialFit is 1. Detailed explanations with graphical examples can be found in the Georeferencing Best Practices, Chapman and Wieczorek, 2020 (https://doi.org/10.15468/doc-gg7h-s853).
Examples
  • 0
  • 1
  • 1.5708
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/FootprintSpatialFit
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-06-28_40
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:footprintSRS
Term IRI http://rs.tdwg.org/dwc/terms/footprintSRS
Modified 2025-06-12
Term version IRI http://rs.tdwg.org/dwc/terms/version/footprintSRS-2025-06-12
Label Footprint SRS
Definition The ellipsoid, geodetic datum, or spatial reference system (SRS) upon which the geometry given in dwc:footprintWKT is based.
Notes Recommended best practice is to use the EPSG code of the SRS, if known. Otherwise use a controlled vocabulary for the name or code of the geodetic datum, if known. Otherwise use a controlled vocabulary for the name or code of the ellipsoid, if known. If none of these is known, use the value not recorded. It is also permitted to provide the SRS in Well-Known-Text, especially if no EPSG code provides the necessary values for the attributes of the SRS. Do not use this term to describe the SRS of the dwc:decimalLatitude and dwc:decimalLongitude, nor of any verbatim coordinates - use the dwc:geodeticDatum and dwc:verbatimSRS instead. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples
  • EPSG:4326
  • GEOGCS["GCS_WGS_1984", DATUM["D_WGS_1984", SPHEROID["WGS_1984",6378137,298.257223563]], PRIMEM["Greenwich",0], UNIT["Degree",0.0174532925199433]] (WKT for the standard WGS84 Spatial Reference System EPSG:4326)
  • not recorded
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2021-07-15_34
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-06-12_44
Term Name dwciri:footprintSRS
Term IRI http://rs.tdwg.org/dwc/iri/footprintSRS
Modified 2025-06-12
Term version IRI http://rs.tdwg.org/dwc/iri/version/footprintSRS-2025-06-12
Label Footprint SRS (IRI)
Definition The ellipsoid, geodetic datum, or spatial reference system (SRS) upon which the geometry given in dwc:footprintWKT is based.
Notes Recommended best practice is to use an IRI for the EPSG code of the SRS, if known. Otherwise use a controlled vocabulary IRI for the name or code of the geodetic datum, if known. Otherwise use a controlled vocabulary IRI for the name or code of the ellipsoid, if known. Otherwise use an IRI for the value corresponding to not recorded.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2021-07-15_34
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-06-12_44
Term Name dwc:footprintWKT
Term IRI http://rs.tdwg.org/dwc/terms/footprintWKT
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/footprintWKT-2026-05-26
Label Footprint WKT
Definition A Well-Known Text (WKT) representation of the shape (footprint, geometry) that defines a dcterms:Location.
Notes A dcterms:Location may have both a point-radius representation (see dwc:decimalLatitude) and a footprint representation, and they may differ from each other.
Examples POLYGON ((10 20, 11 20, 11 21, 10 21, 10 20)) (the one-degree bounding box with opposite corners at longitude=10, latitude=20 and longitude=11, latitude=21)
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/FootprintWKT (ABCD v2.06b)
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwciri:footprintWKT
Term IRI http://rs.tdwg.org/dwc/iri/footprintWKT
Modified 2025-07-10
Term version IRI http://rs.tdwg.org/dwc/iri/version/footprintWKT-2025-07-10
Label Footprint WKT (IRI)
Definition A Well-Known Text (WKT) representation of the shape (footprint, geometry) that defines the dcterms:Location. A dcterms:Location may have both a point-radius representation (see dwc:decimalLatitude) and a footprint representation, and they may differ from each other.
Notes Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-07-10_50
Term Name dwc:formation
Term IRI http://rs.tdwg.org/dwc/terms/formation
Modified 2023-09-13
Term version IRI http://rs.tdwg.org/dwc/terms/version/formation-2023-09-13
Label Formation
Definition The full name of the lithostratigraphic formation from which the dwc:MaterialEntity was collected.
Examples
  • Notch Peak Formation
  • House Limestone
  • Fillmore Formation
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-09-13_41
Executive Committee decision http://rs.tdwg.org/decisions/decision-2024-02-28_43
Term Name dwc:FossilSpecimen
Term IRI http://rs.tdwg.org/dwc/terms/FossilSpecimen
Modified 2023-09-18
Term version IRI http://rs.tdwg.org/dwc/terms/version/FossilSpecimen-2023-09-18
Label Fossil Specimen
Definition A preserved specimen that is a fossil.
Examples
  • a body fossil
  • a coprolite
  • a gastrolith
  • an ichnofossil
  • a piece of a petrified tree
ABCD equivalence RecordBasisEnum/FossileSpecimen
Type Class
Executive Committee decision http://rs.tdwg.org/decisions/decision-2014-10-26_15
Term Name dwciri:fromLithostratigraphicUnit
Term IRI http://rs.tdwg.org/dwc/iri/fromLithostratigraphicUnit
Modified 2015-03-27
Term version IRI http://rs.tdwg.org/dwc/iri/version/fromLithostratigraphicUnit-2015-03-27
Label From Lithostratigraphic Unit
Definition Use to link a dwc:GeologicalContext instance to an IRI-identified lithostratigraphic unit at the lowest possible level in a hierarchy.
Notes Recommended best practice is to use an IRI from a controlled vocabulary. A "convenience property" that replaces Darwin Core literal-value terms related to geological context. See Section 2.7.7 of the Darwin Core RDF Guide for details.
ABCD equivalence not in ABCD
Type Property
Term Name dwciri:fundingAttribution
Term IRI http://rs.tdwg.org/dwc/iri/fundingAttribution
Modified 2025-07-10
Term version IRI http://rs.tdwg.org/dwc/iri/version/fundingAttribution-2025-07-10
Label Funding Attribution (IRI)
Definition An organization or agency that provided funding for a project.
Notes Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-06-12_44
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-07-10_50
Term Name ac:fundingAttribution
Term IRI http://rs.tdwg.org/ac/terms/fundingAttribution
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/ac/terms/version/fundingAttribution-2020-01-27
Label Funding Attribution
Definition Text description of organizations or individuals who funded the creation of the resource.
Notes Specify the full official name of the funding body. This should include the complete name without abbreviations, unless the abbreviation is an official and commonly recognized form (e.g., NSF for the National Science Foundation). The recommended best practice is to separate the values in a list with space vertical bar space ( | ).
Examples
  • Artsdatabanken
  • National Science Foundation
  • Norges forskningsråd
  • Ocean Census | Nippon Foundation
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2019-12-01_19
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-06-12_44
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:fundingAttributionID
Term IRI http://rs.tdwg.org/dwc/terms/fundingAttributionID
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/fundingAttributionID-2026-05-26
Label Funding Attribution ID
Definition An identifier for a dcterms:Agent that financially supported a project.
Notes Provide a unique identifier for the funding body, such as an identifier used in governmental or international databases. If no official identifier exists, use a persistent and unique identifier within your organization or dataset. Recommended best practice is to separate the values in a list with space vertical bar space ( | ).
Examples
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-06-12_44
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:Generalizations
Term IRI http://rs.tdwg.org/dwc/terms/Generalizations
Modified 2009-04-24
Label Generalizations
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/dataGeneralizations
Definition Actions taken to make the data as shared less specific or complete than in its original form. Suggests that alternative data of highly quality may be available on request.
Notes Examples: "Coordinates generalized from original GPS coordinates to the nearest half degree grid cell", "locality information given only to nearest county".
ABCD equivalence not in ABCD
Type Property
Term Name dwc:genericName
Term IRI http://rs.tdwg.org/dwc/terms/genericName
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/genericName-2023-06-28
Label Generic Name
Definition The genus part of the dwc:scientificName without authorship.
Notes For synonyms the accepted genus and the genus part of the name may be different. The term dwc:genericName should be used together with dwc:specificEpithet to form a binomial and with dwc:infraspecificEpithet to form a trinomial. The term dwc:genericName should only be used for combinations. Uninomials of generic rank do not have a dwc:genericName.
Examples Felis (for scientificName Felis concolor, with accompanying values of Puma concolor in acceptedNameUsage and Puma in genus)
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2021-07-15_34
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-12-11_54
Term Name dwc:genus
Term IRI http://rs.tdwg.org/dwc/terms/genus
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/genus-2023-06-28
Label Genus
Definition The full scientific name of the genus in which the dwc:Taxon is classified.
Examples
  • Puma
  • Monoclea
ABCD equivalence {DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Bacterial/GenusOrMonomial or DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Botanical/GenusOrMonomial or DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Viral/GenusOrMonomial or DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Zoological/GenusOrMonomial}
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2024-02-28_43
Term Name dwc:geodeticDatum
Term IRI http://rs.tdwg.org/dwc/terms/geodeticDatum
Modified 2025-06-12
Term version IRI http://rs.tdwg.org/dwc/terms/version/geodeticDatum-2025-06-12
Label Geodetic Datum
Definition The ellipsoid, geodetic datum, or spatial reference system (SRS) upon which the geographic coordinates given in dwc:decimalLatitude and dwc:decimalLongitude are based.
Notes Recommended best practice is to use the EPSG code of the SRS, if known. Otherwise use a controlled vocabulary for the name or code of the geodetic datum, if known. Otherwise use a controlled vocabulary for the name or code of the ellipsoid, if known. If none of these is known, use the value not recorded. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for a string literal value.
Examples
  • EPSG:4326
  • WGS84
  • NAD27
  • Campo Inchauspe
  • European 1950
  • Clarke 1866
  • not recorded
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesLatLon/SpatialDatum
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-06-12_44
Term Name dwciri:geodeticDatum
Term IRI http://rs.tdwg.org/dwc/iri/geodeticDatum
Modified 2025-06-12
Term version IRI http://rs.tdwg.org/dwc/iri/version/geodeticDatum-2025-06-12
Label Geodetic Datum (IRI)
Definition The ellipsoid, geodetic datum, or spatial reference system (SRS) upon which the geographic coordinates given in dwc:decimalLatitude and dwc:decimalLongitude are based.
Notes Recommended best practice is to use an IRI for the EPSG code of the SRS, if known. Otherwise use a controlled vocabulary for the name or code of the geodetic datum, if known. Otherwise use a controlled vocabulary for the name or code of the ellipsoid, if known. If none of these is known, use an IRI corresponding to the value not recorded.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-06-12_44
Term Name dwc:GeologicalContext
Term IRI http://rs.tdwg.org/dwc/terms/GeologicalContext
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/GeologicalContext-2026-05-26
Label Geological Context
Definition A set of geological designations, such as stratigraphy, that qualifies a dcterms:Location or source of a dwc:MaterialEntity.
Examples
  • a particular lithostratigraphic layer
  • a specific chronostratigraphic unit
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/Stratigraphy
Type Class
Executive Committee decision http://rs.tdwg.org/decisions/decision-2014-10-26_15
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:geologicalContextID
Term IRI http://rs.tdwg.org/dwc/terms/geologicalContextID
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/geologicalContextID-2023-06-28
Label Geological Context ID
Definition An identifier for the set of information associated with a dwc:GeologicalContext (the location within a geological context, such as stratigraphy). May be a global unique identifier or an identifier specific to the data set.
Examples https://opencontext.org/subjects/e54377f7-4452-4315-b676-40679b10c4d9
ABCD equivalence not in ABCD
Type Property
Term Name dwc:georeferencedBy
Term IRI http://rs.tdwg.org/dwc/terms/georeferencedBy
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/georeferencedBy-2026-05-26
Label Georeferenced By
Definition A name for a dcterms:Agent responsible for providing a georeference.
Notes Recommended best practice is to separate the values in a list with space vertical bar space ( | ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples
  • Brad Millen (ROM)
  • Kristina Yamamoto | Janet Fang
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2014-10-30_16
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwciri:georeferencedBy
Term IRI http://rs.tdwg.org/dwc/iri/georeferencedBy
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/iri/version/georeferencedBy-2026-05-26
Label Georeferenced By (IRI)
Definition An IRI identifying a dcterms:Agent responsible for providing a georeference.
Notes Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-07-10_50
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:georeferencedDate
Term IRI http://rs.tdwg.org/dwc/terms/georeferencedDate
Modified 2025-06-12
Term version IRI http://rs.tdwg.org/dwc/terms/version/georeferencedDate-2025-06-12
Label Georeferenced Date
Definition The date on which the dcterms:Location was georeferenced.
Notes Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples
  • 1963-03-08T14:07-06:00 (8 Mar 1963 at or after 2:07pm and before 2:08pm in the time zone six hours earlier than UTC)
  • 2009-02-20T08:40Z (20 February 2009 at or after 8:40am and before 8:41 UTC)
  • 2018-08-29T15:19 (29 August 2018 at or after 3:19pm and before 3:20pm local time)
  • 1809-02-12 (within the day 12 February 1809)
  • 1906-06 (in the month of June 1906)
  • 1971 (in the year 1971)
  • 2007-03-01T13:00:00Z/2008-05-11T15:30:00Z (some time within the interval beginning 1 March 2007 at 1pm UTC and before 11 May 2008 at 3:30pm UTC)
  • 1900/1909 (some time within the interval between the beginning of the year 1900 and before the year 1909)
  • 2007-11-13/15 (some time in the interval between the beginning of 13 November 2007 and before 15 November 2007)
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2011-10-16_9
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-06-12_44
Term Name dwciri:georeferenceProtocol
Term IRI http://rs.tdwg.org/dwc/iri/georeferenceProtocol
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/iri/version/georeferenceProtocol-2026-05-26
Label Georeference Protocol (IRI)
Definition A description or reference to a dwc:Protocol used to determine a spatial footprint, coordinates, and uncertainties.
Notes Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-07-10_50
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:georeferenceProtocol
Term IRI http://rs.tdwg.org/dwc/terms/georeferenceProtocol
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/georeferenceProtocol-2026-05-26
Label Georeference Protocol
Definition A description or reference to a dwc:Protocol used to determine a spatial footprint, coordinates, and uncertainties.
Notes This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples Georeferencing Quick Reference Guide (Zermoglio et al. 2020, https://doi.org/10.35035/e09p-h128)
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinateMethod
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:georeferenceRemarks
Term IRI http://rs.tdwg.org/dwc/terms/georeferenceRemarks
Modified 2025-06-12
Term version IRI http://rs.tdwg.org/dwc/terms/version/georeferenceRemarks-2025-06-12
Label Georeference Remarks
Definition Comments or notes about the spatial description determination, explaining assumptions made in addition or opposition to the those formalized in the method referred to in dwc:georeferenceProtocol.
Examples Assumed distance by road (Hwy. 101)
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/GeoreferenceRemarks
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-06-12_44
Term Name dwc:georeferenceSources
Term IRI http://rs.tdwg.org/dwc/terms/georeferenceSources
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/georeferenceSources-2026-05-26
Label Georeference Sources
Definition A list (concatenated and separated) of maps, gazetteers, or other resources used to georeference a dcterms:Location, described specifically enough to allow anyone in the future to use the same resources.
Notes Recommended best practice is to separate the values in a list with space vertical bar space ( | ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/GeoreferenceSources
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2014-10-30_16
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwciri:georeferenceSources
Term IRI http://rs.tdwg.org/dwc/iri/georeferenceSources
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/iri/version/georeferenceSources-2026-05-26
Label Georeference Sources (IRI)
Definition An IRI for a map, gazetteer, or other resource used to georeference a dcterms:Location.
Notes Recommended best practice is describe a georeference with no more than one sampled georeference source. In the case of a georeference that cannot be attributed to a specific source, the recommended best practice is to repeat the property for each IRI that denotes a different source that applies to the georeference. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-07-10_50
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwciri:georeferenceVerificationStatus
Term IRI http://rs.tdwg.org/dwc/iri/georeferenceVerificationStatus
Modified 2025-07-10
Term version IRI http://rs.tdwg.org/dwc/iri/version/georeferenceVerificationStatus-2025-07-10
Label Georeference Verification Status (IRI)
Definition A categorical description of the extent to which the georeference has been verified to represent the best possible spatial description for the dcterms:Location of the dwc:Occurrence.
Notes Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2021-07-15_34
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-07-10_50
Term Name dwc:georeferenceVerificationStatus
Term IRI http://rs.tdwg.org/dwc/terms/georeferenceVerificationStatus
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/georeferenceVerificationStatus-2023-06-28
Label Georeference Verification Status
Definition A categorical description of the extent to which the georeference has been verified to represent the best possible spatial description for the dcterms:Location of the dwc:Occurrence.
Notes Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples
  • unable to georeference
  • requires georeference
  • requires verification
  • verified by data custodian
  • verified by contributor
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/GeoreferenceVerificationStatus
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2021-07-15_34
Term Name dwc:group
Term IRI http://rs.tdwg.org/dwc/terms/group
Modified 2023-09-13
Term version IRI http://rs.tdwg.org/dwc/terms/version/group-2023-09-13
Label Group
Definition The full name of the lithostratigraphic group from which the dwc:MaterialEntity was collected.
Examples
  • Bathurst
  • Lower Wealden
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-09-13_41
Executive Committee decision http://rs.tdwg.org/decisions/decision-2024-02-28_43
Term Name dwc:habitat
Term IRI http://rs.tdwg.org/dwc/terms/habitat
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/habitat-2023-06-28
Label Habitat
Definition A category or description of the habitat in which the dwc:Event occurred.
Notes This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples
  • oak savanna
  • pre-cordilleran steppe
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/Biotope/Text
Type Property
Term Name dwciri:habitat
Term IRI http://rs.tdwg.org/dwc/iri/habitat
Modified 2025-07-10
Term version IRI http://rs.tdwg.org/dwc/iri/version/habitat-2025-07-10
Label Habitat (IRI)
Definition A category or description of the habitat in which the dwc:Event occurred.
Notes Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-07-10_50
Term Name dwc:higherClassification
Term IRI http://rs.tdwg.org/dwc/terms/higherClassification
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/higherClassification-2023-06-28
Label Higher Classification
Definition A list (concatenated and separated) of taxa names terminating at the rank immediately superior to the referenced dwc:Taxon.
Notes Recommended best practice is to separate the values in a list with space vertical bar space ( | ), with terms in order from the highest taxonomic rank to the lowest.
Examples
  • Plantae | Tracheophyta | Magnoliopsida | Ranunculales | Ranunculaceae | Ranunculus
  • Animalia
  • Animalia | Chordata | Vertebrata | Mammalia | Theria | Eutheria | Rodentia | Hystricognatha | Hystricognathi | Ctenomyidae | Ctenomyini | Ctenomys
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2014-10-30_16
Term Name dwc:higherGeography
Term IRI http://rs.tdwg.org/dwc/terms/higherGeography
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/higherGeography-2023-06-28
Label Higher Geography
Definition A list (concatenated and separated) of geographic names less specific than the information captured in the dwc:locality term.
Notes Recommended best practice is to separate the values in a list with space vertical bar space ( | ), with terms in order from least specific to most specific.
Examples
  • North Atlantic Ocean
  • South America | Argentina | Patagonia | Parque Nacional Nahuel Huapi | Neuquén | Los Lagos with accompanying values South America (continent) Argentina (country), Neuquén (first order division), and Los Lagos (second order division)
ABCD equivalence {DataSets/DataSet/Units/Unit/Gathering/LocalityText or DataSets/DataSet/Units/Unit/Gathering/NamedAreas/NamedArea/AreaName}
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2014-10-30_16
Term Name dwc:higherGeographyID
Term IRI http://rs.tdwg.org/dwc/terms/higherGeographyID
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/higherGeographyID-2023-06-28
Label Higher Geography ID
Definition An identifier for the geographic region within which the dcterms:Location occurred.
Notes Recommended best practice is to use a persistent identifier from a controlled vocabulary such as the Getty Thesaurus of Geographic Names.
Examples http://vocab.getty.edu/tgn/1002002 (Antártida e Islas del Atlántico Sur, Territorio Nacional de la Tierra del Fuego, Argentina).
ABCD equivalence not in ABCD
Type Property
Term Name dwc:HigherTaxon
Term IRI http://rs.tdwg.org/dwc/terms/HigherTaxon
Modified 2009-08-24
Label Higher Taxon
This term is deprecated and should no longer be used.
Definition A list (concatenated and separated) of the names for the taxonomic ranks less specific than the ScientificName.
Notes Example: "Animalia, Chordata, Vertebrata, Mammalia, Theria, Eutheria, Rodentia, Hystricognatha, Hystricognathi, Ctenomyidae, Ctenomyini, Ctenomys".
ABCD equivalence DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/HigherTaxa/HigherTaxon/HigherTaxonName
Type Property
Term Name dwc:higherTaxonconceptID
Term IRI http://rs.tdwg.org/dwc/terms/higherTaxonconceptID
Modified 2009-08-24
Label Higher Taxon Concept ID
This term is deprecated and should no longer be used.
Definition A unique identifier for the taxon concept less specific than that given in the taxonConceptID.
ABCD equivalence not in ABCD
Type Property
Term Name dwc:HigherTaxonID
Term IRI http://rs.tdwg.org/dwc/terms/HigherTaxonID
Modified 2009-08-24
Label Higher Taxon ID
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/higherTaxonNameID
Definition A global unique identifier for the parent to the taxon.
ABCD equivalence not in ABCD
Type Property
Term Name dwc:higherTaxonName
Term IRI http://rs.tdwg.org/dwc/terms/higherTaxonName
Modified 2009-08-24
Label Higher Taxon Name
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/higherClassification
Definition A list (concatenated and separated) of the names for the taxonomic ranks less specific than that given in the scientificName.
Notes Example: "Animalia; Chordata; Vertebrata; Mammalia; Theria; Eutheria; Rodentia; Hystricognatha; Hystricognathi; Ctenomyidae; Ctenomyini; Ctenomys"
ABCD equivalence DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/HigherTaxa/HigherTaxon/HigherTaxonName
Type Property
Term Name dwc:higherTaxonNameID
Term IRI http://rs.tdwg.org/dwc/terms/higherTaxonNameID
Modified 2009-08-24
Label Higher Taxon Name ID
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/parentNameUsageID
Definition A unique identifier for the name of the next higher rank than the scientificName in a taxonomic classification. See higherTaxonName.
ABCD equivalence not in ABCD
Type Property
Term Name dwc:highestBiostratigraphicZone
Term IRI http://rs.tdwg.org/dwc/terms/highestBiostratigraphicZone
Modified 2023-09-13
Term version IRI http://rs.tdwg.org/dwc/terms/version/highestBiostratigraphicZone-2023-09-13
Label Highest Biostratigraphic Zone
Definition The full name of the highest possible geological biostratigraphic zone of the stratigraphic horizon from which the dwc:MaterialEntity was collected.
Examples Blancan
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-09-13_41
Term Name dwc:HumanObservation
Term IRI http://rs.tdwg.org/dwc/terms/HumanObservation
Modified 2023-09-18
Term version IRI http://rs.tdwg.org/dwc/terms/version/HumanObservation-2023-09-18
Label Human Observation
Definition An output of a human observation process.
Examples
  • evidence of a dwc:Occurrence taken from field notes or literature
  • a record of a dwc:Occurrence without physical evidence or evidence captured with a machine
ABCD equivalence RecordBasisEnum/HumanObservation
Type Class
Executive Committee decision http://rs.tdwg.org/decisions/decision-2014-10-26_15
Term Name dwc:Identification
Term IRI http://rs.tdwg.org/dwc/terms/Identification
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/Identification-2026-05-26
Label Identification
Definition A classification of a resource according to a classification scheme.
Notes For biology, the assignment of a scientific name or taxon concept to a dwc:Organism.
Examples
  • a subspecies determination of an organism
  • a nomenclatural act designating a specimen as a holotype
ABCD equivalence DataSets/DataSet/Units/Unit/Identifications/Identification
Type Class
Executive Committee decision http://rs.tdwg.org/decisions/decision-2014-10-26_15
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:identificationAttributes
Term IRI http://rs.tdwg.org/dwc/terms/identificationAttributes
Modified 2009-10-09
Label Identification Attributes
This term is deprecated and should no longer be used.
Definition A list (concatenated and separated) of additional measurements, facts, characteristics, or assertions about the Identification.
Notes Example: "natureOfID=expert identification; identificationEvidence=cytochrome B sequence"
ABCD equivalence not in ABCD
Type Property
Term Name dwc:identificationID
Term IRI http://rs.tdwg.org/dwc/terms/identificationID
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/identificationID-2026-05-26
Label Identification ID
Definition An identifier for a dwc:Identification.
Notes Recommended best practice is to use a globally unique identifier.
Examples 9992
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwciri:identificationQualifier
Term IRI http://rs.tdwg.org/dwc/iri/identificationQualifier
Modified 2025-07-10
Term version IRI http://rs.tdwg.org/dwc/iri/version/identificationQualifier-2025-07-10
Label Identification Qualifier (IRI)
Definition A controlled value to express the determiner's doubts about the dwc:Identification.
Notes Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-07-10_50
Term Name dwc:identificationQualifier
Term IRI http://rs.tdwg.org/dwc/terms/identificationQualifier
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/identificationQualifier-2023-06-28
Label Identification Qualifier
Definition A brief phrase or a standard term ("cf.", "aff.") to express the determiner's doubts about the dwc:Identification.
Notes This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples
  • aff. agrifolia var. oxyadenia (for Quercus aff. agrifolia var. oxyadenia with accompanying values Quercus in genus, agrifolia in specificEpithet, oxyadenia in infraspecificEpithet, and var. in taxonRank)
  • cf. var. oxyadenia (for Quercus agrifolia cf. var. oxyadenia with accompanying values Quercus in genus, agrifolia in specificEpithet, oxyadenia in infraspecificEpithet, and var. in taxonRank)
ABCD equivalence DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/IdentificationQualifier
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2019-12-01_19
Term Name dwc:identificationReferences
Term IRI http://rs.tdwg.org/dwc/terms/identificationReferences
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/identificationReferences-2026-05-26
Label Identification References
Definition A list (concatenated and separated) of dcterms:BibliographicResources used in a dwc:Identification.
Notes When used in the context of an eco:Survey, the subject consists of all of the dwc:Identifications related to the eco:Survey. Recommended best practice is to separate the values in a list with space vertical bar space ( | ).
Examples
  • Aves del Noroeste Patagonico. Christie et al. 2004.
  • Stebbins, R. Field Guide to Western Reptiles and Amphibians. 3rd Edition. 2003. | Irschick, D.J. and Shaffer, H.B. (1997). The polytypic species revisited: Morphological differentiation among tiger salamanders (Ambystoma tigrinum) (Amphibia: Caudata). Herpetologica, 53(1), 30-49.
ABCD equivalence DataSets/DataSet/Units/Unit/Identifications/Identification/References
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2014-10-30_16
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-06-12_44
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:identificationRemarks
Term IRI http://rs.tdwg.org/dwc/terms/identificationRemarks
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/identificationRemarks-2023-06-28
Label Identification Remarks
Definition Comments or notes about the dwc:Identification.
Examples Distinguished between Anthus correndera and Anthus hellmayri based on the comparative lengths of the uñas.
ABCD equivalence DataSets/DataSet/Units/Unit/Identifications/Identification/Notes
Type Property
Term Name dwc:identificationType
Term IRI http://rs.tdwg.org/dwc/terms/identificationType
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/identificationType-2026-05-26
Label Identification Type
Definition A category that best matches the nature of a dwc:Identification.
Notes The evidentiary basis, analytical approach, or inferential method by which an identification was determined. Values describe the dominant source of information supporting the identification (e.g., morphology, geography, molecular data, functional attributes, relationships, or taxonomic revision), independent of confidence level or taxonomic outcome. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples
  • geography
  • taxonomicRevision
  • functionalAttributes
  • nucleotideAnalysis
  • karyotype
  • media
  • relationship
  • features
  • fineFeatures
  • unknown
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwciri:identificationType
Term IRI http://rs.tdwg.org/dwc/iri/identificationType
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/iri/version/identificationType-2026-05-26
Label Identification Type (IRI)
Definition A category that best matches the nature of a dwc:Identification.
Notes The evidentiary basis, analytical approach, or inferential method by which an identification was determined. Values describe the dominant source of information supporting the identification (e.g., morphology, geography, molecular data, functional attributes, relationships, or taxonomic revision), independent of confidence level or taxonomic outcome. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:identificationVerificationStatus
Term IRI http://rs.tdwg.org/dwc/terms/identificationVerificationStatus
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/identificationVerificationStatus-2026-05-26
Label Identification Verification Status
Definition A categorical indicator of the extent to which a taxonomic determination has been verified to be correct.
Notes Recommended best practice is to use a controlled vocabulary such as that used in HISPID and ABCD. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples 0 (unverified in HISPID/ABCD)
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2011-10-16_10
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwciri:identificationVerificationStatus
Term IRI http://rs.tdwg.org/dwc/iri/identificationVerificationStatus
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/iri/version/identificationVerificationStatus-2026-05-26
Label Identification Verification Status (IRI)
Definition A categorical indicator of the extent to which a taxonomic determination has been verified to be correct.
Notes Recommended best practice is to use a controlled vocabulary such as that used in HISPID and ABCD. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-07-10_50
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:identifiedBy
Term IRI http://rs.tdwg.org/dwc/terms/identifiedBy
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/identifiedBy-2026-05-26
Label Identified By
Definition A name for a dcterms:Agent responsible for making a dwc:Identification.
Notes When used in the context of an eco:Survey, the subject consists of all of the dwc:Identifications related to the eco:Survey. Recommended best practice is to separate the values in a list with space vertical bar space ( | ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples
  • James L. Patton
  • Theodore Pappenfuss | Robert Macey
  • MegaDetector V5
ABCD equivalence DataSets/DataSet/Units/Unit/Identifications/Identification/Identifiers/IdentifiersText
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2014-10-30_16
Executive Committee decision http://rs.tdwg.org/decisions/decision-2019-12-01_19
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-06-12_44
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwciri:identifiedBy
Term IRI http://rs.tdwg.org/dwc/iri/identifiedBy
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/iri/version/identifiedBy-2026-05-26
Label Identified By (IRI)
Definition An IRI identifying a dcterms:Agent responsible for making a dwc:Identification.
Notes When used in the context of an eco:Survey, the subject consists of all of the dwc:Identifications related to the eco:Survey. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-06-12_44
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-07-10_50
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:identifiedByID
Term IRI http://rs.tdwg.org/dwc/terms/identifiedByID
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/identifiedByID-2026-05-26
Label Identified By ID
Definition An identifier for a dcterms:Agent responsible for making a dwc:Identification.
Notes When used in the context of an eco:Survey, the subject consists of all of the dwc:Identifications related to the eco:Survey. Recommended best practice is to provide a single identifier that disambiguates the details of the identifying dcterms:Agent. If a list is used, the order of the identifiers on the list should not be assumed to convey any semantics. Recommended best practice is to separate the values in a list with space vertical bar space ( | ).
Examples
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2021-07-15_34
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwciri:inCollection
Term IRI http://rs.tdwg.org/dwc/iri/inCollection
Modified 2015-03-27
Term version IRI http://rs.tdwg.org/dwc/iri/version/inCollection-2015-03-27
Label In Collection
Definition Use to link any subject resource that is part of a collection to the collection containing the resource.
Notes Recommended best practice is to use an IRI from a controlled registry. A "convenience property" that replaces literal-value terms related to collections and institutions. See Section 2.7.3 of the Darwin Core RDF Guide for details.
ABCD equivalence not in ABCD
Type Property
Term Name dwciri:inDataset
Term IRI http://rs.tdwg.org/dwc/iri/inDataset
Modified 2015-03-27
Term version IRI http://rs.tdwg.org/dwc/iri/version/inDataset-2015-03-27
Label In Dataset
Definition Use to link a subject dataset record to the dataset which contains it.
Notes A string literal name of the dataset can be provided using the term dwc:datasetName. See the Darwin Core RDF Guide for details.
ABCD equivalence not in ABCD
Type Property
Term Name dwciri:inDescribedPlace
Term IRI http://rs.tdwg.org/dwc/iri/inDescribedPlace
Modified 2015-03-27
Term version IRI http://rs.tdwg.org/dwc/iri/version/inDescribedPlace-2015-03-27
Label In Described Place
Definition Use to link a dcterms:Location instance subject to the lowest level standardized hierarchically-described resource.
Notes Recommended best practice is to use an IRI from a controlled registry. A "convenience property" that replaces Darwin Core literal-value terms related to locations. See Section 2.7.5 of the Darwin Core RDF Guide for details.
Examples http://vocab.getty.edu/tgn/1019987
ABCD equivalence not in ABCD
Type Property
Term Name dwc:individualCount
Term IRI http://rs.tdwg.org/dwc/terms/individualCount
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/individualCount-2023-06-28
Label Individual Count
Definition The number of individuals present at the time of the dwc:Occurrence.
Examples
  • 0
  • 1
  • 25
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/LowerValue
Type Property
Term Name dwc:individualID
Term IRI http://rs.tdwg.org/dwc/terms/individualID
Modified 2014-10-23
Label Individual ID
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/organismID
Definition An identifier for an individual or named group of individual organisms represented in the Occurrence. Meant to accommodate resampling of the same individual or group for monitoring purposes. May be a global unique identifier or an identifier specific to a data set.
Notes Examples: "U.amer. 44", "Smedley", "Orca J 23"
ABCD equivalence DataSets/DataSet/Units/Unit/Identifications/Identification/Result/TaxonIdentified/ScientificName/NameAtomised/Zoological/NamedIndividual or DataSets/DataSet/Units/Unit/ObservationUnit/ObservationUnitIdentifiers/ObservationUnitIdentifier or DataSets/DataSet/Units/Unit/SpecimenUnit/Accessions/AccessionNumber
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2014-10-26_14
Executive Committee decision http://rs.tdwg.org/decisions/decision-2014-10-30_16
Term Name dwciri:informationWithheld
Term IRI http://rs.tdwg.org/dwc/iri/informationWithheld
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/iri/version/informationWithheld-2026-05-26
Label Information Withheld (IRI)
Definition Additional information that exists about a resource, but that is not shared publicly. Suggests that alternative data of higher quality may be available on request.
Notes Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-07-10_50
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:informationWithheld
Term IRI http://rs.tdwg.org/dwc/terms/informationWithheld
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/informationWithheld-2026-05-26
Label Information Withheld
Definition Additional information that exists about a resource, but that is not shared publicly. Suggests that alternative data of higher quality may be available on request.
Notes This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples
  • location information not given for endangered species
  • collector identities withheld | ask about tissue samples
ABCD equivalence DataSets/DataSet/Units/Unit/InformationWithheld
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:infragenericEpithet
Term IRI http://rs.tdwg.org/dwc/terms/infragenericEpithet
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/infragenericEpithet-2023-06-28
Label Infrageneric Epithet
Definition The infrageneric part of a binomial name at ranks above species but below genus.
Notes The term dwc:infragenericEpithet should be used in conjunction with dwc:genericName, dwc:specificEpithet, dwc:infraspecificEpithet, dwc:taxonRank and dwc:scientificNameAuthorship to represent the individual elements of the complete dwc:scientificName. It can be used to indicate the subgenus placement of a species, which in zoology is often given in parentheses. Can also be used to share infrageneric names such as botanical sections (e.g., Vicia sect. Cracca).
Examples
  • Abacetillus (for scientificName Abacetus (Abacetillus) ambiguus)
  • Cracca (for scientificName Vicia sect. Cracca)
ABCD equivalence DataSets/DataSet/Units/Unit/Identifications/Identification/Result/TaxonIdentified/ScientificName/NameAtomised/Bacterial/Subgenus (for bacterial names) or DataSets/DataSet/Units/Unit/Identifications/Identification/Result/TaxonIdentified/ScientificName/NameAtomised/Zoological/Subgenus (for zoological names) or DataSets/DataSet/Units/Unit/Identifications/Identification/Result/TaxonIdentified/ScientificName/NameAtomised/Botanical/FirstEpithet (for botanical names)
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2021-07-15_34
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-12-11_54
Term Name dwc:infraspecificEpithet
Term IRI http://rs.tdwg.org/dwc/terms/infraspecificEpithet
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/infraspecificEpithet-2026-05-26
Label Infraspecific Epithet
Definition The name of the lowest or terminal infraspecific of the dwc:scientificName.
Notes In botany, name strings in literature and identifications may have multiple infraspecific ranks. According to the International Code of Nomenclature for algae, fungi, and plants (Shenzhen Code Articles 6.7 & Art. 24.1), valid names only have two epithets, with the lowest rank being the dwc:infraspecificEpithet. For example: the dwc:infraspecificEpithet in the string Indigofera charlieriana subsp. sessilis var. scaberrima is scaberrima and the dwc:scientificName is Indigofera charlieriana var. scaberrima. Use dwc:verbatimIdentification for the full name string used in a dwc:Identification.
Examples
  • concolor (for scientificName Puma concolor concolor)
  • oxyadenia (for scientificName Quercus agrifolia var. oxyadenia)
  • laxa (for scientificName Cheilanthes hirta f. laxa)
  • scaberrima (for scientificName Indigofera charlieriana var. scaberrima)
ABCD equivalence DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Bacterial/SubspeciesEpithet or DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Botanical/SecondEpithet or DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Zoological/SubspeciesEpithet
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-06-28_40
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-12-11_54
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:institutionCode
Term IRI http://rs.tdwg.org/dwc/terms/institutionCode
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/institutionCode-2026-05-26
Label Institution Code
Definition A name (or acronym) in use by an institution having custody of a resource.
Notes The institution having ownership of a resource should be given in dwc:ownerInstitutionCode.
Examples
  • MVZ
  • FMNH
  • CLO
  • UCMP
  • National Museum of Kenya
  • Kew Gardens
ABCD equivalence DataSets/DataSet/Units/Unit/SourceInstitutionID
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:institutionID
Term IRI http://rs.tdwg.org/dwc/terms/institutionID
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/institutionID-2026-05-26
Label Institution ID
Definition An identifier for an organization.
Notes For physical specimens, the recommended best practice is to use a globally unique and resolvable identifier from a collections registry such as the Research Organization Registry (ROR) or the Global Registry of Scientific Collections (https://scientific-collections.gbif.org/).
Examples
ABCD equivalence DataSets/DataSet/Units/Unit/SourceInstitutionID
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-06-12_44
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:isAcceptedIdentification
Term IRI http://rs.tdwg.org/dwc/terms/isAcceptedIdentification
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/isAcceptedIdentification-2026-05-26
Label Is Accepted Identification
Definition An indicator that a dwc:Identification of a dwc:Organism is a currently an accepted or preferred one.
Notes Recommended best practice is to follow the TDWG Boolean Controlled Vocabulary http://rs.tdwg.org/tag/doc/boolean/.
Examples
  • true
  • false
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:island
Term IRI http://rs.tdwg.org/dwc/terms/island
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/island-2023-06-28
Label Island
Definition The name of the island on or near which the dcterms:Location occurs.
Notes Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names.
Examples
  • Nosy Be
  • Bikini Atoll
  • Vancouver
  • Viti Levu
  • Zanzibar
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/NamedAreas/NamedArea/AreaName with NamedAreas/NamedArea/AreaClass= Island
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2024-02-28_43
Term Name dwc:islandGroup
Term IRI http://rs.tdwg.org/dwc/terms/islandGroup
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/islandGroup-2023-06-28
Label Island Group
Definition The name of the island group in which the dcterms:Location occurs.
Notes Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names.
Examples
  • Alexander Archipelago
  • Archipiélago Diego Ramírez
  • Seychelles
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/NamedAreas/NamedArea/AreaName with NamedAreas/NamedArea/AreaClass= Island group
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2024-02-28_43
Term Name dwc:kingdom
Term IRI http://rs.tdwg.org/dwc/terms/kingdom
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/kingdom-2023-06-28
Label Kingdom
Definition The full scientific name of the kingdom in which the dwc:Taxon is classified.
Examples
  • Animalia
  • Archaea
  • Bacteria
  • Chromista
  • Fungi
  • Plantae
  • Protozoa
  • Viruses
ABCD equivalence DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/HigherTaxa/HigherTaxon/HigherTaxonName with HigherTaxa/HigherTaxon/HigherTaxonRank = regnum
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2024-02-28_43
Term Name dcterms:language
Term IRI http://purl.org/dc/terms/language
Modified 2008-01-14
Term version IRI http://dublincore.org/usage/terms/history/#languageT-001
Label Language
Definition A language of the resource.
Notes Recommended best practice is to use an IRI from the Library of Congress ISO 639-2 scheme http://id.loc.gov/vocabulary/iso639-2
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2019-12-01_19
Term Name dc:language
Term IRI http://purl.org/dc/elements/1.1/language
Modified 2023-06-28
Term version IRI http://dublincore.org/usage/terms/history/#language-007
Label Language
Definition A language of the resource.
Notes Recommended best practice is to use a controlled vocabulary such as RFC 5646. This term has an equivalent in the dcterms: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples
  • en (for English)
  • es (for Spanish)
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2019-12-01_19
Term Name dwc:latestAgeOrHighestStage
Term IRI http://rs.tdwg.org/dwc/terms/latestAgeOrHighestStage
Modified 2023-09-13
Term version IRI http://rs.tdwg.org/dwc/terms/version/latestAgeOrHighestStage-2023-09-13
Label Latest Age Or Highest Stage
Definition The full name of the latest possible geochronologic age or highest chronostratigraphic stage attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected.
Examples
  • Atlantic
  • Boreal
  • Skullrockian
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-09-13_41
Executive Committee decision http://rs.tdwg.org/decisions/decision-2024-02-28_43
Term Name dwc:LatestDateCollected
Term IRI http://rs.tdwg.org/dwc/terms/LatestDateCollected
Modified 2009-04-24
Label Latest Date Collected
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/eventDate
Definition The latest date-time in a period during which a event occurred. If the event is recorded as occurring at a single date-time, populate both EarliestDateCollected and LatestDateCollected with the same value. Recommended best practice is to use an encoding scheme, such as ISO 8601:2004(E).
Notes Date may be used to express temporal information at any level of granularity. Recommended best practice is to use an encoding scheme, such as the W3CDTF profile of ISO 8601 [W3CDTF].
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/ISODateTimeEnd
Type Property
Term Name dwc:latestEonOrHighestEonothem
Term IRI http://rs.tdwg.org/dwc/terms/latestEonOrHighestEonothem
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/latestEonOrHighestEonothem-2026-05-26
Label Latest Eon Or Highest Eonothem
Definition The full name of the latest possible geochronologic eon or highest chronostratigraphic eonothem or the informal name attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected.
Examples
  • Phanerozoic
  • Proterozoic
  • Precambrian
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-09-13_41
Executive Committee decision http://rs.tdwg.org/decisions/decision-2024-02-28_43
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-06-12_44
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:latestEpochOrHighestSeries
Term IRI http://rs.tdwg.org/dwc/terms/latestEpochOrHighestSeries
Modified 2023-09-13
Term version IRI http://rs.tdwg.org/dwc/terms/version/latestEpochOrHighestSeries-2023-09-13
Label Latest Epoch Or Highest Series
Definition The full name of the latest possible geochronologic epoch or highest chronostratigraphic series attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected.
Examples
  • Holocene
  • Pleistocene
  • Ibexian Series
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-09-13_41
Executive Committee decision http://rs.tdwg.org/decisions/decision-2024-02-28_43
Term Name dwc:latestEraOrHighestErathem
Term IRI http://rs.tdwg.org/dwc/terms/latestEraOrHighestErathem
Modified 2023-09-13
Term version IRI http://rs.tdwg.org/dwc/terms/version/latestEraOrHighestErathem-2023-09-13
Label Latest Era Or Highest Erathem
Definition The full name of the latest possible geochronologic era or highest chronostratigraphic erathem attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected.
Examples
  • Cenozoic
  • Mesozoic
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-09-13_41
Executive Committee decision http://rs.tdwg.org/decisions/decision-2024-02-28_43
Term Name dwciri:latestGeochronologicalEra
Term IRI http://rs.tdwg.org/dwc/iri/latestGeochronologicalEra
Modified 2023-09-13
Term version IRI http://rs.tdwg.org/dwc/iri/version/latestGeochronologicalEra-2023-09-13
Label Latest Geochronological Era
Definition Use to link a dwc:GeologicalContext instance to chronostratigraphic time periods at the lowest possible level in a standardized hierarchy. Use this property to point to the latest possible geological time period from which the dwc:MaterialEntity was collected.
Notes Recommended best practice is to use an IRI from a controlled vocabulary. A "convenience property" that replaces Darwin Core literal-value terms related to geological context. See Section 2.7.6 of the Darwin Core RDF Guide for details.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-09-13_41
Term Name dwc:latestPeriodOrHighestSystem
Term IRI http://rs.tdwg.org/dwc/terms/latestPeriodOrHighestSystem
Modified 2023-09-13
Term version IRI http://rs.tdwg.org/dwc/terms/version/latestPeriodOrHighestSystem-2023-09-13
Label Latest Period Or Highest System
Definition The full name of the latest possible geochronologic period or highest chronostratigraphic system attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected.
Examples
  • Neogene
  • Tertiary
  • Quaternary
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-09-13_41
Executive Committee decision http://rs.tdwg.org/decisions/decision-2024-02-28_43
Term Name dcterms:license
Term IRI http://purl.org/dc/terms/license
Modified 2023-06-28
Term version IRI http://dublincore.org/usage/terms/history/#license-002
Label License
Definition A legal document giving official permission to do something with the resource.
Examples
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2014-11-06_17
Executive Committee decision http://rs.tdwg.org/decisions/decision-2024-02-28_43
Term Name dwc:lifeStage
Term IRI http://rs.tdwg.org/dwc/terms/lifeStage
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/lifeStage-2026-05-26
Label Life Stage
Definition An age class or life stage of a dwc:Organism.
Notes Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples
  • zygote
  • larva
  • juvenile
  • adult
  • seedling
  • flowering
  • fruiting
ABCD equivalence DataSets/DataSet/Units/Unit/MycologicalUnit/MycologicalSexualStage or DataSets/DataSet/Units/Unit/MycologicalUnit/MycologicalLiveStages/MycologicalLiveStage or DataSets/DataSet/Units/Unit/ZoologicalUnit/PhasesOrStages/PhaseOrStage
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2019-12-01_19
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-02-24_55
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwciri:lifeStage
Term IRI http://rs.tdwg.org/dwc/iri/lifeStage
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/iri/version/lifeStage-2026-05-26
Label Life Stage (IRI)
Definition An age class or life stage of a dwc:Organism.
Notes Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-07-10_50
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:lithostratigraphicTerms
Term IRI http://rs.tdwg.org/dwc/terms/lithostratigraphicTerms
Modified 2025-06-12
Term version IRI http://rs.tdwg.org/dwc/terms/version/lithostratigraphicTerms-2025-06-12
Label Lithostratigraphic Terms
Definition The combination of all lithostratigraphic names for the rock from which the dwc:MaterialEntity was collected.
Examples Pleistocene-Weichselien
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/Stratigraphy/LithostratigraphicTerms
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-09-13_41
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-06-12_44
Term Name dwc:LivingSpecimen
Term IRI http://rs.tdwg.org/dwc/terms/LivingSpecimen
Modified 2023-09-18
Term version IRI http://rs.tdwg.org/dwc/terms/version/LivingSpecimen-2023-09-18
Label Living Specimen
Definition A specimen that is alive.
Examples
  • a living plant in a botanical garden
  • a living animal in a zoo
ABCD equivalence RecordBasisEnum/LivingSpecimen
Type Class
Executive Committee decision http://rs.tdwg.org/decisions/decision-2014-10-26_15
Term Name dwc:locality
Term IRI http://rs.tdwg.org/dwc/terms/locality
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/locality-2023-06-28
Label Locality
Definition The specific description of the place.
Notes Less specific geographic information can be provided in other geographic terms (dwc:higherGeography, dwc:continent, dwc:country, dwc:stateProvince, dwc:county, dwc:municipality, dwc:waterBody, dwc:island, dwc:islandGroup). This term may contain information modified from the original to correct perceived errors or standardize the description.
Examples
  • Bariloche, 25 km NNE via Ruta Nacional 40 (=Ruta 237)
  • Queets Rainforest, Olympic National Park
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/NamedAreas/NamedArea/AreaName
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2024-02-28_43
Term Name dcterms:Location
Term IRI http://purl.org/dc/terms/Location
Modified 2023-09-18
Term version IRI http://dublincore.org/usage/terms/history/#Location-001
Label Location
Definition A spatial region or named place.
Examples
  • the municipality of San Carlos de Bariloche, Río Negro, Argentina
  • the place defined by a georeference
ABCD equivalence not in ABCD
Type Class
Term Name dwciri:locationAccordingTo
Term IRI http://rs.tdwg.org/dwc/iri/locationAccordingTo
Modified 2025-07-10
Term version IRI http://rs.tdwg.org/dwc/iri/version/locationAccordingTo-2025-07-10
Label Location According To (IRI)
Definition Information about the source of this dcterms:Location information. Could be a publication (gazetteer), institution, or team of individuals.
Notes Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-07-10_50
Term Name dwc:locationAccordingTo
Term IRI http://rs.tdwg.org/dwc/terms/locationAccordingTo
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/locationAccordingTo-2023-06-28
Label Location According To
Definition Information about the source of this dcterms:Location information. Could be a publication (gazetteer), institution, or team of individuals.
Notes This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples
  • Getty Thesaurus of Geographic Names
  • GADM
ABCD equivalence not in ABCD
Type Property
Term Name dwc:locationAttributes
Term IRI http://rs.tdwg.org/dwc/terms/locationAttributes
Modified 2014-10-23
Label Location Attributes
This term is deprecated and should no longer be used.
Definition A list (concatenated and separated) of additional measurements, facts, characteristics, or assertions about the location.
Notes Example: "aspectheading=277; slopeindegrees=6"
ABCD equivalence not in ABCD
Type Property
Term Name dwc:locationID
Term IRI http://rs.tdwg.org/dwc/terms/locationID
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/locationID-2026-05-26
Label Location ID
Definition An identifier for a dcterms:Location.
Notes Recommended best practice is to use a globally unique identifier.
Examples https://opencontext.org/subjects/768A875F-E205-4D0B-DE55-BAB7598D0FD1
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:locationRemarks
Term IRI http://rs.tdwg.org/dwc/terms/locationRemarks
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/locationRemarks-2023-06-28
Label Location Remarks
Definition Comments or notes about the dcterms:Location.
Examples under water since 2005
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/AreaDetail
Type Property
Term Name dwc:lowestBiostratigraphicZone
Term IRI http://rs.tdwg.org/dwc/terms/lowestBiostratigraphicZone
Modified 2023-09-13
Term version IRI http://rs.tdwg.org/dwc/terms/version/lowestBiostratigraphicZone-2023-09-13
Label Lowest Biostratigraphic Zone
Definition The full name of the lowest possible geological biostratigraphic zone of the stratigraphic horizon from which the dwc:MaterialEntity was collected.
Examples Maastrichtian
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-09-13_41
Term Name dwc:MachineObservation
Term IRI http://rs.tdwg.org/dwc/terms/MachineObservation
Modified 2023-09-18
Term version IRI http://rs.tdwg.org/dwc/terms/version/MachineObservation-2023-09-18
Label Machine Observation
Definition An output of a machine observation process.
Examples
  • a photograph
  • a video
  • an audio recording
  • a remote sensing image
  • a dwc:Occurrence record based on telemetry
ABCD equivalence RecordBasisEnum/MachineObservation
Type Class
Executive Committee decision http://rs.tdwg.org/decisions/decision-2014-10-26_15
Term Name dwc:MaterialCitation
Term IRI http://rs.tdwg.org/dwc/terms/MaterialCitation
Modified 2023-09-18
Term version IRI http://rs.tdwg.org/dwc/terms/version/MaterialCitation-2023-09-18
Label Material Citation
Definition A reference to or citation of one, a part of, or multiple specimens in scholarly publications.
Notes This class constitutes a new value for the controlled vocabulary in the recommendations for basisOfRecord. When importing Darwin Core Archives of literature-based datasets to GBIF, the basisOfRecord should be changed from "Occurrence", "PreservedSpecimen" or "Literature" to "MaterialCitation".
Examples
  • a citation of a physical specimen from a scientific collection in a taxonomic treatment in a scientific publication
  • a citation of a group of physical specimens, such as paratypes in a taxonomic treatment in a scientific publication
ABCD equivalence not in ABCD
Type Class
Executive Committee decision http://rs.tdwg.org/decisions/decision-2021-07-15_34
Term Name dwc:MaterialEntity
Term IRI http://rs.tdwg.org/dwc/terms/MaterialEntity
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/MaterialEntity-2026-05-26
Label Material Entity
Definition An entity that can be identified, exists for some period of time, and consists in whole or in part of physical matter while it exists.
Notes The term is defined at the most general level to admit descriptions of any subtype of material entity within the scope of Darwin Core. In particular, any kind of material sample, preserved specimen, fossil, or exemplar from living collections is intended to be subsumed under this term. In Darwin Core, dwc:Organism, dwc:Occurrence, and dwc:MaterialEntity are related, but distinct concepts. A dwc:Organism is a biological individual or group with an identity and life history that persists independently of the particular dwc:MaterialEntities through which it is manifested. A dwc:Occurrence is a dwc:Event that represents the presence or state of a dwc:Organism at a place during an interval of time, with no explicit dependency on any dwc:MaterialEntity. A dwc:MaterialEntity represents physical matter, including whole bodies, parts, or derivatives of dwc:Organisms, that may directly or indirectly serve as evidence of a dwc:Occurrence.
Examples
  • the entire contents of a trawl
  • a subset of the contents of a trawl
  • the body of a fish
  • the stomach contents of a fish
  • a rock containing fossils
  • a fossil within a rock
  • an herbarium sheet with its attached plant specimen
  • a flower on a plant specimen
  • a pollen grain
  • a specific water sample
  • an isolated molecule of DNA
ABCD equivalence not in ABCD (Specimen Unit, when used to denote a class of things, appears to be a broadly construed subclass.)
Type Class
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-09-13_41
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwciri:materialEntityCategory
Term IRI http://rs.tdwg.org/dwc/iri/materialEntityCategory
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/iri/version/materialEntityCategory-2026-05-26
Label Material Entity Category (IRI)
Definition A high-level, mutually exclusive classification describing the fundamental substance and origin of a dwc:MaterialEntity.
Notes Recommended best practice is to use a limited, tightly controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:materialEntityCategory
Term IRI http://rs.tdwg.org/dwc/terms/materialEntityCategory
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/materialEntityCategory-2026-05-26
Label Material Entity Category
Definition A high-level, mutually exclusive classification describing the fundamental substance and origin of a dwc:MaterialEntity.
Notes Recommended best practice is to use a limited, tightly controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples liveOrganism, deadOrganism, partOfOrganism, nonMolecularBiologicalExtract, molecularBiologicalExtract, mineral, rock, fossil, chemical, humanArtifactWithBiologicalConstituent, humanArtifactWithoutBiologicalConstituent, and mixed
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:materialEntityID
Term IRI http://rs.tdwg.org/dwc/terms/materialEntityID
Modified 2023-09-13
Term version IRI http://rs.tdwg.org/dwc/terms/version/materialEntityID-2023-09-13
Label Material Entity ID
Definition An identifier for a particular instance of a dwc:MaterialEntity.
Notes Values of dwc:materialEntityID are intended to uniquely and persistently identify a particular dwc:MaterialEntity within some context. Examples of context include a particular sample collection, an organization, or the worldwide scale. Recommended best practice is to use a persistent, globally unique identifier. The identifier is bound to a physical object (the dwc:MaterialEntity) as opposed to a particular digital record (representation) of that physical object.
Examples 06809dc5-f143-459a-be1a-6f03e63fc083
ABCD equivalence Unit/UnitGUID or Unit/UnitID
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-09-13_41
Term Name dwc:materialEntityRemarks
Term IRI http://rs.tdwg.org/dwc/terms/materialEntityRemarks
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/materialEntityRemarks-2026-05-26
Label Material Entity Remarks
Definition Comments or notes about a dwc:MaterialEntity.
Examples
  • found in association with charred remains
  • some original fragments missing
ABCD equivalence DataSets/DataSet/Units/Unit/Notes
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-09-13_41
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwciri:materialEntityType
Term IRI http://rs.tdwg.org/dwc/iri/materialEntityType
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/iri/version/materialEntityType-2026-05-26
Label Material Entity Type (IRI)
Definition A more generic classification of a dwc:MaterialEntity than dwc:preparations but less broad than dwc:materialCategory.
Notes A more generic classification of a dwc:MaterialEntity than dwc:preparations. Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:materialEntityType
Term IRI http://rs.tdwg.org/dwc/terms/materialEntityType
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/materialEntityType-2026-05-26
Label Material Entity Type
Definition A more generic classification of a dwc:MaterialEntity than dwc:preparations but less broad than dwc:materialCategory.
Notes A more generic classification of a dwc:MaterialEntity than dwc:preparations. Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
ABCD equivalence skos:closeMatch to /DataSets/DataSet/Units/Unit/KindOfUnit. ABCD structural considerations prevent an exactMatch.
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-06-12_44
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:MaterialSample
Term IRI http://rs.tdwg.org/dwc/terms/MaterialSample
Modified 2023-09-13
Term version IRI http://rs.tdwg.org/dwc/terms/version/MaterialSample-2023-09-13
Label Material Sample
Definition A material entity that represents an entity of interest in whole or in part.
Examples
  • a whole organism preserved in a collection
  • a part of an organism isolated for some purpose
  • a soil sample
  • a marine microbial sample
ABCD equivalence DataSets/DataSet/Units/Unit
Type Class
Executive Committee decision http://rs.tdwg.org/decisions/decision-2013-10-09_11
Executive Committee decision http://rs.tdwg.org/decisions/decision-2014-10-26_15
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-09-13_41
Term Name dwc:materialSampleID
Term IRI http://rs.tdwg.org/dwc/terms/materialSampleID
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/materialSampleID-2023-06-28
Label Material Sample ID
Definition An identifier for the dwc:MaterialSample (as opposed to a particular digital record of the dwc:MaterialSample). In the absence of a persistent global unique identifier, construct one from a combination of identifiers in the record that will most closely make the dwc:materialSampleID globally unique.
Notes Recommended best practice is to use a persistent, globally unique identifier.
Examples 06809dc5-f143-459a-be1a-6f03e63fc083
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2013-10-09_13
Term Name dwc:maximumDepthInMeters
Term IRI http://rs.tdwg.org/dwc/terms/maximumDepthInMeters
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/maximumDepthInMeters-2026-05-26
Label Maximum Depth In Meters
Definition The greatest depth within a range of depths, measured relative to the vertical reference surface indicated by the value of dwc:verticalDatum.
Notes See https://docs.gbif.org/georeferencing-best-practices/1.0/en/#img-depth-elevation-distance-above-surface.
Examples
  • 0
  • 200
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/UpperValue
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:maximumDistanceAboveSurfaceInMeters
Term IRI http://rs.tdwg.org/dwc/terms/maximumDistanceAboveSurfaceInMeters
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/maximumDistanceAboveSurfaceInMeters-2023-06-28
Label Maximum Distance Above Surface In Meters
Definition The greater distance in a range of distance from a reference surface in the vertical direction, in meters. Use positive values for locations above the surface, negative values for locations below. If depth measures are given, the reference surface is the location given by the depth, otherwise the reference surface is the location given by the elevation.
Examples
  • -1.5 (below the surface)
  • 4.2 (above the surface)
  • For a 1.5 meter sediment core from the bottom of a lake (at depth 20m) at 300m elevation: verbatimElevation: 300m minimumElevationInMeters: 300, maximumElevationInMeters: 300, verbatimDepth: 20m, minimumDepthInMeters: 20, maximumDepthInMeters: 20, minimumDistanceAboveSurfaceInMeters: 0, maximumDistanceAboveSurfaceInMeters: -1.5.
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/UpperValue
Type Property
Term Name dwc:maximumElevationInMeters
Term IRI http://rs.tdwg.org/dwc/terms/maximumElevationInMeters
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/maximumElevationInMeters-2026-05-26
Label Maximum Elevation In Meters
Definition The greatest elevation within a range of elevations, measured relative to the vertical reference surface indicated by the value of dwc:verticalDatum.
Notes See https://docs.gbif.org/georeferencing-best-practices/1.0/en/#img-depth-elevation-distance-above-surface.
Examples
  • -205
  • 1236
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/UpperValue
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:measurementAccuracy
Term IRI http://rs.tdwg.org/dwc/terms/measurementAccuracy
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/measurementAccuracy-2023-06-28
Label Measurement Accuracy
Definition The description of the potential error associated with the dwc:measurementValue.
Examples
  • 0.01
  • normal distribution with variation of 2 m
ABCD equivalence DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Accuracy or DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Aspect/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Accuracy
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2024-02-28_43
Term Name dwc:measurementDeterminedBy
Term IRI http://rs.tdwg.org/dwc/terms/measurementDeterminedBy
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/measurementDeterminedBy-2023-06-28
Label Measurement Determined By
Definition A list (concatenated and separated) of names of people, groups, or organizations who determined the value of the dwc:MeasurementOrFact.
Notes Recommended best practice is to separate the values in a list with space vertical bar space ( | ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples
  • Rob Guralnick
  • Peter Desmet | Stijn Van Hoey
ABCD equivalence DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/MeasuredBy
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2014-10-30_16
Term Name dwciri:measurementDeterminedBy
Term IRI http://rs.tdwg.org/dwc/iri/measurementDeterminedBy
Modified 2025-07-10
Term version IRI http://rs.tdwg.org/dwc/iri/version/measurementDeterminedBy-2025-07-10
Label Measurement Determined By (IRI)
Definition A person, group, or organization who determined the value of the dwc:MeasurementOrFact.
Notes Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-07-10_50
Term Name dwc:measurementDeterminedDate
Term IRI http://rs.tdwg.org/dwc/terms/measurementDeterminedDate
Modified 2025-06-12
Term version IRI http://rs.tdwg.org/dwc/terms/version/measurementDeterminedDate-2025-06-12
Label Measurement Determined Date
Definition The date on which the dwc:MeasurementOrFact was made.
Notes Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples
  • 1963-03-08T14:07-06:00 (8 Mar 1963 at or after 2:07pm and before 2:08pm in the time zone six hours earlier than UTC)
  • 2009-02-20T08:40Z (20 February 2009 at or after 8:40am and before 8:41 UTC)
  • 2018-08-29T15:19 (29 August 2018 at or after 3:19pm and before 3:20pm local time)
  • 1809-02-12 (within the day 12 February 1809)
  • 1906-06 (in the month of June 1906)
  • 1971 (in the year 1971)
  • 2007-03-01T13:00:00Z/2008-05-11T15:30:00Z (some time within the interval beginning 1 March 2007 at 1pm UTC and before 11 May 2008 at 3:30pm UTC)
  • 1900/1909 (some time within the interval between the beginning of the year 1900 and before the year 1909)
  • 2007-11-13/15 (some time in the interval between the beginning of 13 November 2007 and before 15 November 2007)
ABCD equivalence DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/MeasurementDateTime
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-06-12_44
Term Name dwc:measurementID
Term IRI http://rs.tdwg.org/dwc/terms/measurementID
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/measurementID-2023-06-28
Label Measurement ID
Definition An identifier for the dwc:MeasurementOrFact (information pertaining to measurements, facts, characteristics, or assertions). May be a global unique identifier or an identifier specific to the data set.
Examples 9c752d22-b09a-11e8-96f8-529269fb1459
ABCD equivalence not in ABCD
Type Property
Term Name dwc:measurementMethod
Term IRI http://rs.tdwg.org/dwc/terms/measurementMethod
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/measurementMethod-2023-06-28
Label Measurement Method
Definition A description of or reference to (publication, URI) the method or protocol used to determine the measurement, fact, characteristic, or assertion.
Notes This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples
  • minimum convex polygon around burrow entrances (for a home range area)
  • barometric altimeter (for an elevation)
ABCD equivalence /DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Method or /DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/Method or /DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/Method
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2024-02-28_43
Term Name dwciri:measurementMethod
Term IRI http://rs.tdwg.org/dwc/iri/measurementMethod
Modified 2025-07-10
Term version IRI http://rs.tdwg.org/dwc/iri/version/measurementMethod-2025-07-10
Label Measurement Method (IRI)
Definition The method or protocol used to determine the measurement, fact, characteristic, or assertion.
Notes Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-07-10_50
Term Name dwc:MeasurementOrFact
Term IRI http://rs.tdwg.org/dwc/terms/MeasurementOrFact
Modified 2023-09-13
Term version IRI http://rs.tdwg.org/dwc/terms/version/MeasurementOrFact-2023-09-13
Label Measurement Or Fact
Definition A measurement of or fact about an rdfs:Resource (http://www.w3.org/2000/01/rdf-schema#Resource).
Notes Resources can be thought of as identifiable records or instances of classes and may include, but need not be limited to instances of dwc:Occurrence, dwc:Organism, dwc:MaterialEntity, dwc:Event, dcterms:Location, dwc:GeologicalContext, dwc:Identification, or dwc:Taxon.
Examples
  • the weight of a dwc:Organism in grams
  • the number of placental scars
  • surface water temperature in Celsius
ABCD equivalence Datasets/Dataset/Units/Unit/MeasurementsOrFacts or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts
Type Class
Executive Committee decision http://rs.tdwg.org/decisions/decision-2014-10-26_15
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-09-13_41
Term Name dwc:measurementRemarks
Term IRI http://rs.tdwg.org/dwc/terms/measurementRemarks
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/measurementRemarks-2023-06-28
Label Measurement Remarks
Definition Comments or notes accompanying the dwc:MeasurementOrFact.
Examples tip of tail missing
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2024-02-28_43
Term Name dwciri:measurementType
Term IRI http://rs.tdwg.org/dwc/iri/measurementType
Modified 2025-07-10
Term version IRI http://rs.tdwg.org/dwc/iri/version/measurementType-2025-07-10
Label Measurement Type (IRI)
Definition The nature of the measurement, fact, characteristic, or assertion.
Notes Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-07-10_50
Term Name dwc:measurementType
Term IRI http://rs.tdwg.org/dwc/terms/measurementType
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/measurementType-2023-06-28
Label Measurement Type
Definition The nature of the measurement, fact, characteristic, or assertion.
Notes Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples
  • tail length
  • temperature
  • trap line length
  • survey area
  • trap type
ABCD equivalence DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Parameter or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Parameter
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2024-02-28_43
Term Name dwc:measurementUnit
Term IRI http://rs.tdwg.org/dwc/terms/measurementUnit
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/measurementUnit-2023-06-28
Label Measurement Unit
Definition The units associated with the dwc:measurementValue.
Notes Recommended best practice is to use the International System of Units (SI). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples
  • m
  • g
  • l
  • °C
  • mm
  • km²
  • %
  • hh:mm:ss
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UnitOfMeasurement or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UnitOfMeasurement
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2024-02-28_43
Term Name dwciri:measurementUnit
Term IRI http://rs.tdwg.org/dwc/iri/measurementUnit
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/iri/version/measurementUnit-2023-06-28
Label Measurement Unit (IRI)
Definition The units associated with the dwc:measurementValue.
Notes Recommended best practice is to use a controlled vocabulary such as the Ontology of Units of Measure http://www.wurvoc.org/vocabularies/om-1.8/ of SI units, derived units, or other non-SI units accepted for use within the SI.
ABCD equivalence not in ABCD
Type Property
Term Name dwc:measurementValue
Term IRI http://rs.tdwg.org/dwc/terms/measurementValue
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/measurementValue-2023-06-28
Label Measurement Value
Definition The value of the measurement, fact, characteristic, or assertion.
Notes This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples
  • 45
  • 20
  • 1
  • 14.5
  • UV-light
ABCD equivalence DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/UpperValue
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2024-02-28_43
Term Name dwciri:measurementValue
Term IRI http://rs.tdwg.org/dwc/iri/measurementValue
Modified 2025-07-10
Term version IRI http://rs.tdwg.org/dwc/iri/version/measurementValue-2025-07-10
Label Measurement Value (IRI)
Definition The value of the measurement, fact, characteristic, or assertion.
Notes Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples http://vocab.nerc.ac.uk/collection/L22/current/TOOL0960/
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2021-07-15_34
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-07-10_50
Term Name ac:Media
Term IRI http://rs.tdwg.org/ac/terms/Media
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/ac/terms/version/Media-2026-02-24
Label Media Entity
Definition A digital or physical media resource.
Notes An instance of digital textual media may be better represented as a dcterms:BibliographicResource.
Examples
  • dcmi:Sound
  • dcmi:StillImage
  • dcmi:MovingImage
  • dcmi:InteractiveResource
  • ac:Digital3DResource
ABCD equivalence This term is equivalent to the ABCD term http://rs.tdwg.org/abcd/terms/MultimediaObject .
Type Class
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-02-24_55
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:member
Term IRI http://rs.tdwg.org/dwc/terms/member
Modified 2023-09-13
Term version IRI http://rs.tdwg.org/dwc/terms/version/member-2023-09-13
Label Member
Definition The full name of the lithostratigraphic member from which the dwc:MaterialEntity was collected.
Examples
  • Lava Dam Member
  • Hellnmaria Member
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-09-13_41
Executive Committee decision http://rs.tdwg.org/decisions/decision-2024-02-28_43
Term Name dwc:minimumDepthInMeters
Term IRI http://rs.tdwg.org/dwc/terms/minimumDepthInMeters
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/minimumDepthInMeters-2026-05-26
Label Minimum Depth In Meters
Definition The least depth within a range of depths, measured relative to the vertical reference surface indicated by the value of dwc:verticalDatum.
Notes See https://docs.gbif.org/georeferencing-best-practices/1.0/en/#img-depth-elevation-distance-above-surface.
Examples
  • 0
  • 100
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/LowerValue
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:minimumDistanceAboveSurfaceInMeters
Term IRI http://rs.tdwg.org/dwc/terms/minimumDistanceAboveSurfaceInMeters
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/minimumDistanceAboveSurfaceInMeters-2023-06-28
Label Minimum Distance Above Surface In Meters
Definition The lesser distance in a range of distance from a reference surface in the vertical direction, in meters. Use positive values for locations above the surface, negative values for locations below. If depth measures are given, the reference surface is the location given by the depth, otherwise the reference surface is the location given by the elevation.
Examples
  • -1.5 (below the surface)
  • 4.2 (above the surface)
  • For a 1.5 meter sediment core from the bottom of a lake (at depth 20m) at 300m elevation: verbatimElevation: 300m minimumElevationInMeters: 300, maximumElevationInMeters: 300, verbatimDepth: 20m, minimumDepthInMeters: 20, maximumDepthInMeters: 20, minimumDistanceAboveSurfaceInMeters: 0, maximumDistanceAboveSurfaceInMeters: -1.5.
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/LowerValue
Type Property
Term Name dwc:minimumElevationInMeters
Term IRI http://rs.tdwg.org/dwc/terms/minimumElevationInMeters
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/minimumElevationInMeters-2026-05-26
Label Minimum Elevation In Meters
Definition The least elevation within a range of elevations, measured relative to the vertical reference surface indicated by the value of dwc:verticalDatum.
Notes See https://docs.gbif.org/georeferencing-best-practices/1.0/en/#img-depth-elevation-distance-above-surface.
Examples
  • -100
  • 802
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/LowerValue
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dcterms:modified
Term IRI http://purl.org/dc/terms/modified
Modified 2025-06-12
Term version IRI http://dublincore.org/usage/terms/history/#modified-003
Label Date Modified
Definition Date on which the resource was changed.
Notes Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples
  • 1963-03-08T14:07-06:00 (8 Mar 1963 at or after 2:07pm and before 2:08pm in the time zone six hours earlier than UTC)
  • 2009-02-20T08:40Z (20 February 2009 at or after 8:40am and before 8:41 UTC)
  • 2018-08-29T15:19 (29 August 2018 at or after 3:19pm and before 3:20pm local time)
  • 1809-02-12 (within the day 12 February 1809)
  • 1906-06 (in the month of June 1906)
  • 1971 (in the year 1971)
  • 2007-03-01T13:00:00Z/2008-05-11T15:30:00Z (some time within the interval beginning 1 March 2007 at 1pm UTC and before 11 May 2008 at 3:30pm UTC)
  • 1900/1909 (some time within the interval between the beginning of the year 1900 and before the year 1909)
  • 2007-11-13/15 (some time in the interval between the beginning of 13 November 2007 and before 15 November 2007)
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2019-12-01_19
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-06-12_44
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-02-24_55
Term Name dwc:MolecularProtocol
Term IRI http://rs.tdwg.org/dwc/terms/MolecularProtocol
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/MolecularProtocol-2026-05-26
Label Molecular Protocol
Definition A protocol used to perform a dwc:NucleotideAnalysis and potentially derive a dwc:NucleotideSequence from a dwc:MaterialEntity.
Examples
  • a standard DNA barcoding workflow using Sanger sequencing
  • a shotgun metagenomics pipeline for microbial community profiling
  • a high-throughput amplicon sequencing protocol targeting 16S rRNA
ABCD equivalence not in ABCD
Type Class
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:molecularProtocolID
Term IRI http://rs.tdwg.org/dwc/terms/molecularProtocolID
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/molecularProtocolID-2026-05-26
Label Molecular Protocol ID
Definition An identifier for a dwc:MolecularProtocol.
Notes Recommended best practice is to use a globally unique identifier.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:month
Term IRI http://rs.tdwg.org/dwc/terms/month
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/month-2023-06-28
Label Month
Definition The integer month in which the dwc:Event occurred.
Examples
  • 1 (January)
  • 10 (October)
ABCD equivalence accessible from DataSets/DataSet/Units/Unit/Gathering/ISODateTimeBegin
Type Property
Term Name dwc:municipality
Term IRI http://rs.tdwg.org/dwc/terms/municipality
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/municipality-2023-06-28
Label Third Order Division
Definition The full, unabbreviated name of the next smaller administrative region than county (city, municipality, etc.) in which the dcterms:Location occurs. Do not use this term for a nearby named place that does not contain the actual dcterms:Location.
Notes Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names. Recommended best practice is to leave this field blank if the dcterms:Location spans multiple entities at this administrative level or if the dcterms:Location might be in one or another of multiple possible entities at this level. Multiplicity and uncertainty of the geographic entity can be captured either in the term dwc:higherGeography or in the term dwc:locality, or both.
Examples
  • Holzminden
  • Araçatuba
  • Ga-Segonyana
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/NamedAreas/NamedArea/AreaName
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-06-28_40
Executive Committee decision http://rs.tdwg.org/decisions/decision-2024-02-28_43
Term Name dwc:nameAccordingTo
Term IRI http://rs.tdwg.org/dwc/terms/nameAccordingTo
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/nameAccordingTo-2026-05-26
Label Name According To
Definition The reference to the source in which the specific taxon concept circumscription is defined or implied - traditionally signified by the Latin "sensu" or "sec." (from secundum, meaning "according to"). For taxa that result from identifications, a reference to the keys, monographs, experts and other sources should be given.
Notes This term provides context to the dwc:scientificName. Together with the dwc:scientificName, separated by sensu or sec., it forms the taxon concept label, which may be seen as having the same relationship to dwc:taxonConceptID as, for example, dwc:acceptedNameUsage has to dwc:acceptedNameUsageID. When not provided, in Taxon Core data sets the dwc:nameAccordingTo can be taken to be the data set. In this case the data set mostly provides sufficient context to infer the delimitation of the taxon and its relationship with other taxa. In Occurrence Core data sets, when not provided, dwc:nameAccordingTo can be an underlying taxonomy of the data set, e.g., Plants of the World Online (http://powo.science.kew.org/) for vascular plant records in iNaturalist (in which case it should be provided), or, which is the case for most dwc:PreservedSpecimen data sets, the dwc:Identification, in which case there is no further context.
Examples Franz NM, Cardona-Duque J (2013) Description of two new species and phylogenetic reassessment of Perelleschus Wibmer & O’Brien, 1986 (Coleoptera: Curculionidae), with a complete taxonomic concept history of Perelleschus sec. Franz & Cardona-Duque, 2013. Syst Biodivers. 11: 209–236. (as the full citation of the Franz & Cardona-Duque (2013) in Perelleschus splendida sec. Franz & Cardona-Duque (2013))
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2019-12-01_19
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-02-24_55
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:nameAccordingToID
Term IRI http://rs.tdwg.org/dwc/terms/nameAccordingToID
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/nameAccordingToID-2023-06-28
Label Name According To ID
Definition An identifier for the source in which the specific taxon concept circumscription is defined or implied. See dwc:nameAccordingTo.
Examples https://doi.org/10.1016/S0269-915X(97)80026-2
ABCD equivalence not in ABCD
Type Property
Term Name dwc:namePublicationID
Term IRI http://rs.tdwg.org/dwc/terms/namePublicationID
Modified 2009-09-21
Label Name Publication ID
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/namePublishedInID
Definition A resolvable globally unique identifier for the original publication of the scientificName.
Notes Example: "http://hdl.handle.net/10199/7"
ABCD equivalence not in ABCD
Type Property
Term Name dwc:namePublishedIn
Term IRI http://rs.tdwg.org/dwc/terms/namePublishedIn
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/namePublishedIn-2023-06-28
Label Name Published In
Definition A reference for the publication in which the dwc:scientificName was originally established under the rules of the associated dwc:nomenclaturalCode.
Notes A citation of the first publication of the name in its given combination, not the basionym / original name. Recombinations are often not published in zoology, in which case dwc:namePublishedIn should be empty.
Examples
  • Pearson O. P., and M. I. Christie. 1985. Historia Natural, 5(37):388
  • Forel, Auguste, Diagnosies provisoires de quelques espèces nouvelles de fourmis de Madagascar, récoltées par M. Grandidier., Annales de la Societe Entomologique de Belgique, Comptes-rendus des Seances 30, 1886
ABCD equivalence DataSets/DataSet/Units/Unit/SpecimenUnit/NomenclaturalTypeDesignations/NomenclaturalTypeDesignation/NomenclaturalReference/TitleCitation
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-06-28_40
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-12-11_54
Term Name dwc:namePublishedInID
Term IRI http://rs.tdwg.org/dwc/terms/namePublishedInID
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/namePublishedInID-2023-06-28
Label Name Published In ID
Definition An identifier for the publication in which the dwc:scientificName was originally established under the rules of the associated dwc:nomenclaturalCode.
Notes A citation of the first publication of the name in its given combination, not the basionym / original name. Recombinations are often not published in zoology, in which case dwc:namePublishedInID should be empty.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-06-28_40
Term Name dwc:namePublishedInYear
Term IRI http://rs.tdwg.org/dwc/terms/namePublishedInYear
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/namePublishedInYear-2023-06-28
Label Name Published In Year
Definition The four-digit year in which the dwc:scientificName was published.
Examples
  • 1915
  • 2008
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2011-10-16_8
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-12-11_54
Term Name dwc:nomenclaturalCode
Term IRI http://rs.tdwg.org/dwc/terms/nomenclaturalCode
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/nomenclaturalCode-2023-06-28
Label Nomenclatural Code
Definition The nomenclatural code (or codes in the case of an ambiregnal name) under which the dwc:scientificName is constructed.
Notes Recommended best practice is to use a controlled vocabulary.
Examples
  • ICN
  • ICZN
  • BC
  • ICNCP
  • BioCode
ABCD equivalence DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/Code
Type Property
Term Name dwc:nomenclaturalStatus
Term IRI http://rs.tdwg.org/dwc/terms/nomenclaturalStatus
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/nomenclaturalStatus-2023-06-28
Label Nomenclatural Status
Definition The status related to the original publication of the name and its conformance to the relevant rules of nomenclature. It is based essentially on an algorithm according to the business rules of the code. It requires no taxonomic opinion.
Examples
  • nom. ambig.
  • nom. illeg.
  • nom. subnud.
ABCD equivalence (DataSets/DataSet/Units/Unit/SpecimenUnit/NomenclaturalTypeDesignations/NomenclaturalTypeDesignation/NomenclaturalReference/TitleCitation) pro parte
Type Property
Term Name dwc:NucleotideAnalysis
Term IRI http://rs.tdwg.org/dwc/terms/NucleotideAnalysis
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/NucleotideAnalysis-2026-05-26
Label Nucleotide Analysis
Definition A link between a dwc:NucleotideSequence or a dwc:Identification and a dwc:Event and a dwc:MaterialEntity from which it was derived, using a specified dwc:Protocol.
ABCD equivalence not in ABCD
Type Class
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:NucleotideSequence
Term IRI http://rs.tdwg.org/dwc/terms/NucleotideSequence
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/NucleotideSequence-2026-05-26
Label Nucleotide Sequence
Definition A digital representation of a nucleotide sequence.
ABCD equivalence not in ABCD
Type Class
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:nucleotideSequenceRemarks
Term IRI http://rs.tdwg.org/dwc/terms/nucleotideSequenceRemarks
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/nucleotideSequenceRemarks-2026-05-26
Label Nucleotide Sequence Remarks
Definition Comments or notes about a dwc:NucleotideSequence.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:objectQuantity
Term IRI http://rs.tdwg.org/dwc/terms/objectQuantity
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/objectQuantity-2026-05-26
Label Object Quantity
Definition A number or enumeration value for the quantity of differentiable dwc:MaterialEntities comprising this dwc:MaterialEntity.
Notes An dwc:objectQuantity must have a corresponding dwc:objectQuantityType.
Examples
  • 27 (objectQuantity) with individuals (objectQuantityType)
  • many (objectQuantity) with individuals (objectQuantityType)
  • 3 (objectQuantity) with legs (objectQuantityType)
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwciri:objectQuantityType
Term IRI http://rs.tdwg.org/dwc/iri/objectQuantityType
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/iri/version/objectQuantityType-2026-05-26
Label Object Quantity Type (IRI)
Definition The type of quantification system used for the quantity of dwc:MaterialEntities.
Notes An dwc:objectQuantityType must have a corresponding dwc:objectQuantity. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:objectQuantityType
Term IRI http://rs.tdwg.org/dwc/terms/objectQuantityType
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/objectQuantityType-2026-05-26
Label Object Quantity Type
Definition The type of quantification system used for the quantity of dwc:MaterialEntities.
Notes An dwc:objectQuantityType must have a corresponding dwc:objectQuantity. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples
  • 27 (objectQuantity) with individuals (objectQuantityType)
  • many (objectQuantity) with individuals (objectQuantityType)
  • 3 (objectQuantity) with legs (objectQuantityType)
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:Occurrence
Term IRI http://rs.tdwg.org/dwc/terms/Occurrence
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/Occurrence-2026-05-26
Label Occurrence
Definition A dwc:Event that establishes the state of a dwc:Organism at a particular place and time.
Notes In Darwin Core, dwc:Organism, dwc:Occurrence, and dwc:MaterialEntity are related, but distinct concepts. A dwc:Organism is a biological individual or group with an identity and life history that persists independently of the particular dwc:MaterialEntities through which it is manifested. A dwc:Occurrence is a dwc:Event that represents the presence or state of a dwc:Organism at a place during an interval of time, with no explicit dependency on any dwc:MaterialEntity. A dwc:MaterialEntity represents physical matter, including whole bodies, parts, or derivatives of dwc:Organisms, that may directly or indirectly serve as evidence of a dwc:Occurrence.
Examples
  • a wolf pack on the shore of Kluane Lake in 1988
  • a virus in a plant leaf in the New York Botanical Garden at 15:29 on 2014-10-23
  • a fungus in Central Park in the summer of 1929
  • a male lance-tailed manakin in a courtship display on Isla Boca Brava
ABCD equivalence DataSets/DataSet/Units/Unit
Type Class
Executive Committee decision http://rs.tdwg.org/decisions/decision-2014-10-26_15
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:occurrenceAttributes
Term IRI http://rs.tdwg.org/dwc/terms/occurrenceAttributes
Modified 2009-10-09
Label Occurrence Attributes
This term is deprecated and should no longer be used.
Definition A list (concatenated and separated) of additional measurements, facts, characteristics, or assertions about the Occurrence.
Notes Examples: "Tragus length: 14mm; Weight: 120g", "Height: 1-1.5 meters tall; flowers yellow; uncommon".
ABCD equivalence DataSets/DataSet/Units/Unit/MeasurementsOrFacts
Type Property
Term Name dwc:occurrenceDetails
Term IRI http://rs.tdwg.org/dwc/terms/occurrenceDetails
Modified 2009-10-09
Label Occurrence Details
This term is deprecated and should no longer be used.
Definition A reference (publication, URI) to the most detailed information available about the Occurrence.
Notes Example: "http://mvzarctos.berkeley.edu/guid/MVZ:Mamm:165861"
ABCD equivalence DataSets/DataSet/Units/Unit/RecordURI
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2011-10-16_7
Term Name dwc:occurrenceID
Term IRI http://rs.tdwg.org/dwc/terms/occurrenceID
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/occurrenceID-2026-05-26
Label Occurrence ID
Definition An identifier for a dwc:Occurrence (as opposed to a particular digital record of a dwc:Occurrence).
Notes In the absence of a persistent global unique identifier, construct one from a combination of identifiers in the record that will most closely make the dwc:occurrenceID globally unique.
Examples
ABCD equivalence DataSets/DataSet/Units/Unit/UnitGUID
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:OccurrenceMeasurement
Term IRI http://rs.tdwg.org/dwc/terms/OccurrenceMeasurement
Modified 2009-10-09
Label Occurrence Measurement
This term is deprecated and should no longer be used.
Definition The category of information pertaining to measurements accociated with an occurrence.
ABCD equivalence Datasets/Dataset/Units/Unit/MeasurementsOrFacts
Type Class
Term Name dwc:occurrenceMeasurementAccuracy
Term IRI http://rs.tdwg.org/dwc/terms/occurrenceMeasurementAccuracy
Modified 2009-10-09
Label Occurrence Measurement Accuracy
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/measurementAccuracy
Definition The description of the error associated with the occurrenceAttributeValue.
Notes Example: "0.01", "normal distribution with variation of 2 m"
ABCD equivalence DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Accuracy
Type Property
Term Name dwc:occurrenceMeasurementDeterminedBy
Term IRI http://rs.tdwg.org/dwc/terms/occurrenceMeasurementDeterminedBy
Modified 2009-10-09
Label Occurrence Measurement Determined By
This term is deprecated and should no longer be used.
Definition The agent responsible for having determined the value of the measurement or characteristic of the occurrence.
Notes Example: "Javier de la Torre"
ABCD equivalence DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/MeasuredBy
Type Property
Term Name dwc:occurrenceMeasurementDeterminedDate
Term IRI http://rs.tdwg.org/dwc/terms/occurrenceMeasurementDeterminedDate
Modified 2009-10-09
Label Occurrence Measurement Determined Date
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/measurementDeterminedDate
Definition The date on which the the measurement or characteristic of the occurrence was made. Recommended best practice is to use an encoding scheme, such as ISO 8601:2004(E).
Notes Examples: "1963-03-08T14:07-0600" is 8 Mar 1963 2:07pm in the time zone six hours earlier than UTC, "2009-02-20T08:40Z" is 20 Feb 2009 8:40am UTC, "1809-02-12" is 12 Feb 1809, "1906-06" is Jun 1906, "1971" is just that year, "2007-03-01T13:00:00Z/2008-05-11T15:30:00Z" is the interval between 1 Mar 2007 1pm UTC and 11 May 2008 3:30pm UTC, "2007-11-13/15" is the interval between 13 Nov 2007 and 15 Nov 2007.
ABCD equivalence DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/MeasurementDateTime
Type Property
Term Name dwc:occurrenceMeasurementID
Term IRI http://rs.tdwg.org/dwc/terms/occurrenceMeasurementID
Modified 2009-10-09
Label Occurrence Measurement ID
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/measurementID
Definition An identifier for the occurrence attribute. May be a global unique identifier or an identifier specific to the data set.
ABCD equivalence not in ABCD
Type Property
Term Name dwc:occurrenceMeasurementRemarks
Term IRI http://rs.tdwg.org/dwc/terms/occurrenceMeasurementRemarks
Modified 2009-10-09
Label Occurrence Measurement Remarks
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/measurementRemarks
Definition Comments or notes accompanying the measurement or characteristic of the occurrence.
Notes Example: "tip of tail missing"
ABCD equivalence not in ABCD
Type Property
Term Name dwc:occurrenceMeasurementType
Term IRI http://rs.tdwg.org/dwc/terms/occurrenceMeasurementType
Modified 2009-10-09
Label Occurrence Measurement Type
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/measurementType
Definition The nature of the measurement or characteristic of the occurrence. Recommended best practice is to use a controlled vocabulary.
Notes Example: "tail length"
ABCD equivalence DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Parameter
Type Property
Term Name dwc:occurrenceMeasurementUnit
Term IRI http://rs.tdwg.org/dwc/terms/occurrenceMeasurementUnit
Modified 2009-10-09
Label Occurrence Measurement Unit
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/measurementUnit
Definition The units for the value of the measurement or characteristic of the occurrence. Recommended best practice is to use International System of Units (SI) units.
Notes Example: "mm"
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UnitOfMeasurement
Type Property
Term Name dwc:occurrenceMeasurementValue
Term IRI http://rs.tdwg.org/dwc/terms/occurrenceMeasurementValue
Modified 2009-10-09
Label Occurrence Measurement Value
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/measurementValue
Definition The value of the measurement or characteristic of the occurrence.
Notes Example: "45"
ABCD equivalence DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UpperValue
Type Property
Term Name dwc:occurrenceRemarks
Term IRI http://rs.tdwg.org/dwc/terms/occurrenceRemarks
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/occurrenceRemarks-2023-06-28
Label Occurrence Remarks
Definition Comments or notes about the dwc:Occurrence.
Examples found dead on road
ABCD equivalence DataSets/DataSet/Units/Unit/Notes
Type Property
Term Name dwciri:occurrenceStatus
Term IRI http://rs.tdwg.org/dwc/iri/occurrenceStatus
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/iri/version/occurrenceStatus-2026-05-26
Label Occurrence Status (IRI)
Definition A statement about the detection or non-detection of a dwc:Organism during a dwc:Event.
Notes Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-07-10_50
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:occurrenceStatus
Term IRI http://rs.tdwg.org/dwc/terms/occurrenceStatus
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/occurrenceStatus-2026-05-26
Label Occurrence Status
Definition A statement about the detection or non-detection of a dwc:Organism during a dwc:Event.
Notes For dwc:Occurrences, the default vocabulary is recommended to consist of detected and notDetected, but can be extended by implementers with good justification. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples
  • detected
  • notDetected
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:order
Term IRI http://rs.tdwg.org/dwc/terms/order
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/order-2023-06-28
Label Order
Definition The full scientific name of the order in which the dwc:Taxon is classified.
Examples
  • Carnivora
  • Monocleales
ABCD equivalence DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/HigherTaxa/HigherTaxon/HigherTaxonName with HigherTaxa/HigherTaxon/HigherTaxonRank = ordo
Type Property
Term Name dwc:Organism
Term IRI http://rs.tdwg.org/dwc/terms/Organism
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/Organism-2026-05-26
Label Organism
Definition A particular organism or defined group of organisms considered to be taxonomically homogeneous.
Notes Instances of the dwc:Organism class are intended to facilitate linking one or more dwc:Identification instances to one or more dwc:Occurrence instances. Therefore, things that are typically assigned scientific names (such as viruses, hybrids, and lichens) and aggregates whose dwc:Occurrences are typically recorded (such as packs, clones, and colonies) are included in the scope of this class. In Darwin Core, dwc:Organism, dwc:Occurrence, and dwc:MaterialEntity are related, but distinct concepts. A dwc:Organism is a biological individual or group with an identity and life history that persists independently of the particular dwc:MaterialEntities through which it is manifested. A dwc:Occurrence is a dwc:Event that represents the presence or state of a dwc:Organism at a place during an interval of time, with no explicit dependency on any dwc:MaterialEntity. A dwc:MaterialEntity represents physical matter, including whole bodies, parts, or derivatives of dwc:Organisms, that may directly or indirectly serve as evidence of a dwc:Occurrence.
Examples
  • a specific bird
  • a specific wolf pack
  • a specific instance of a bacterial culture
  • a particular plant gathered in the wild, transplanted to a botanical garden, and preserved as a specimen in a collection
ABCD equivalence not in ABCD
Type Class
Executive Committee decision http://rs.tdwg.org/decisions/decision-2014-10-26_14
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:organismID
Term IRI http://rs.tdwg.org/dwc/terms/organismID
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/organismID-2023-06-28
Label Organism ID
Definition An identifier for the dwc:Organism instance (as opposed to a particular digital record of the dwc:Organism). May be a globally unique identifier or an identifier specific to the data set.
Examples http://arctos.database.museum/guid/WNMU:Mamm:1249
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2014-10-26_14
Term Name dwc:OrganismInteraction
Term IRI http://rs.tdwg.org/dwc/terms/OrganismInteraction
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/OrganismInteraction-2026-05-26
Label Organism Interaction
Definition An interaction between two dwc:Organisms during a dwc:Event.
Notes Supports only primary observed interactions, not habitual or derived taxon-level interactions. Pairwise interactions must be used to represent multi-organism interactions. When possible, typify the action rather than the state from which an action is inferred, with the actor as the subject dwc:Occurrence and the acted-upon as the related dwc:Occurrence. Only one direction of a two-way interaction is necessary, though both are permissible as distinct OrganismInteractions with distinct subject dwc:Occurrences.
Examples
  • a bee visiting a flower
  • a Mallophora ruficauda hunting an Apis mellifera in flight
  • a viral infection in a plant
  • a female spider mating with a male spider
  • a lion cub nursing from its mother
  • a mosquito sucking blood from a chimpanzee's arm
  • a slug eating a fungus growing on decomposing stump (2 interactions)
ABCD equivalence /abcd:DataSets/abcd:DataSet/abcd:Units/abcd:Unit/abcd:Associations/abcd:UnitAssociation
Type Class
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:organismInteractionDescription
Term IRI http://rs.tdwg.org/dwc/terms/organismInteractionDescription
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/organismInteractionDescription-2026-05-26
Label Organism Interaction Description
Definition A verbatim description of a dwc:OrganismInteraction.
Examples Mallophora ruficauda captured an Apis mellifera worker in flight.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:organismInteractionID
Term IRI http://rs.tdwg.org/dwc/terms/organismInteractionID
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/organismInteractionID-2026-05-26
Label Organism Interaction ID
Definition An identifier for a dwc:OrganismInteraction.
Notes Recommended best practice is to use a globally unique identifier.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:organismInteractionType
Term IRI http://rs.tdwg.org/dwc/terms/organismInteractionType
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/organismInteractionType-2026-05-26
Label Organism Interaction Type
Definition A category that best matches the nature of a dwc:OrganismInteraction.
Notes Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples
  • visitedFlowerOf
  • parasitized
  • matedWith
  • wasAttachedTo
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwciri:organismInteractionType
Term IRI http://rs.tdwg.org/dwc/iri/organismInteractionType
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/iri/version/organismInteractionType-2026-05-26
Label Organism Interaction Type (IRI)
Definition A category that best matches the nature of a dwc:OrganismInteraction.
Notes Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:organismName
Term IRI http://rs.tdwg.org/dwc/terms/organismName
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/organismName-2023-06-28
Label Organism Name
Definition A textual name or label assigned to a dwc:Organism instance.
Examples
  • Huberta
  • Boab Prison Tree
  • J pod
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2014-10-26_14
Term Name dwc:organismQuantity
Term IRI http://rs.tdwg.org/dwc/terms/organismQuantity
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/organismQuantity-2023-06-28
Label Organism Quantity
Definition A number or enumeration value for the quantity of dwc:Organisms.
Notes A dwc:organismQuantity must have a corresponding dwc:organismQuantityType.
Examples
  • 27 (organismQuantity) with individuals (organismQuantityType)
  • 12.5 (organismQuantity) with % biomass (organismQuantityType)
  • r (organismQuantity) with Braun-Blanquet Scale (organismQuantityType)
  • many (organismQuantity) with individuals (organismQuantityType)
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2015-03-19_18
Term Name dwciri:organismQuantityType
Term IRI http://rs.tdwg.org/dwc/iri/organismQuantityType
Modified 2015-03-27
Term version IRI http://rs.tdwg.org/dwc/iri/version/organismQuantityType-2015-03-27
Label Organism Quantity Type (IRI)
Definition The type of quantification system used for the quantity of organisms.
Notes A dwc:organismQuantityType must have a corresponding dwc:organismQuantity.
ABCD equivalence not in ABCD
Type Property
Term Name dwc:organismQuantityType
Term IRI http://rs.tdwg.org/dwc/terms/organismQuantityType
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/organismQuantityType-2023-06-28
Label Organism Quantity Type
Definition The type of quantification system used for the quantity of dwc:Organisms.
Notes A dwc:organismQuantityType must have a corresponding dwc:organismQuantity. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples
  • 27 (organismQuantity) with individuals (organismQuantityType)
  • 12.5 (organismQuantity) with % biomass (organismQuantityType)
  • r (organismQuantity) with Braun-Blanquet Scale (organismQuantityType)
  • many (organismQuantity) with individuals (organismQuantityType)
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2015-03-19_18
Term Name dwc:organismRemarks
Term IRI http://rs.tdwg.org/dwc/terms/organismRemarks
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/organismRemarks-2023-06-28
Label Organism Remarks
Definition Comments or notes about the dwc:Organism instance.
Examples One of a litter of six
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2014-10-26_14
Term Name dwciri:organismScope
Term IRI http://rs.tdwg.org/dwc/iri/organismScope
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/iri/version/organismScope-2026-05-26
Label Organism Scope (IRI)
Definition A description of the kind of dwc:Organism instance. Can be used to indicate whether the dwc:Organism instance represents a discrete organism or if it represents a particular type of aggregation.
Notes Recommended best practice is to use a controlled vocabulary. This term is not intended to be used to specify a type of dwc:Taxon. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:organismScope
Term IRI http://rs.tdwg.org/dwc/terms/organismScope
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/organismScope-2023-06-28
Label Organism Scope
Definition A description of the kind of dwc:Organism instance. Can be used to indicate whether the dwc:Organism instance represents a discrete organism or if it represents a particular type of aggregation.
Notes Recommended best practice is to use a controlled vocabulary. This term is not intended to be used to specify a type of dwc:Taxon. To describe the kind of dwc:Organism using a URI object in RDF, use rdf:type (http://www.w3.org/1999/02/22-rdf-syntax-ns#type) instead.
Examples
  • multicellular organism
  • virus
  • clone
  • pack
  • colony
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2014-10-26_14
Term Name dwc:originalNameUsage
Term IRI http://rs.tdwg.org/dwc/terms/originalNameUsage
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/originalNameUsage-2023-06-28
Label Original Name Usage
Definition The taxon name, with authorship and date information if known, as it originally appeared when first established under the rules of the associated dwc:nomenclaturalCode. The basionym (botany) or basonym (bacteriology) of the dwc:scientificName or the senior/earlier homonym for replaced names.
Notes The full scientific name, with authorship and date information if known, of the name usage in which the terminal element of the dwc:scientificName was originally established under the rules of the associated dwc:nomenclaturalCode. For example, for names governed by the ICNafp, this term would indicate the basionym of a record representing a subsequent combination. Unlike basionyms, however, this term can apply to scientific names at all ranks.
Examples
  • Pinus abies
  • Gasterosteus saltatrix Linnaeus 1768
ABCD equivalence not in ABCD
Type Property
Term Name dwc:originalNameUsageID
Term IRI http://rs.tdwg.org/dwc/terms/originalNameUsageID
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/originalNameUsageID-2023-06-28
Label Original Name Usage ID
Definition An identifier for the name usage (documented meaning of the name according to a source) in which the terminal element of the dwc:scientificName was originally established under the rules of the associated dwc:nomenclaturalCode.
Notes This term should be used to refer to the dwc:taxonID of a dwc:Taxon record that represents the usage of the terminal element of the dwc:scientificName as originally established under the rules of the associated dwc:nomenclaturalCode. For example, for names governed by the ICNafp, this term would establish the relationship between a record representing a subsequent combination and the record for its corresponding basionym. Unlike basionyms, however, this term can apply to scientific names at all ranks. For Darwin Core Archives the related record should be present locally in the same archive.
Examples
  • tsn:41107 (ITIS)
  • urn:lsid:ipni.org:names:320035-2 (IPNI)
  • 2704179 (GBIF)
  • 6W3C4 (COL)
ABCD equivalence not in ABCD
Type Property
Term Name dwc:otherCatalogNumbers
Term IRI http://rs.tdwg.org/dwc/terms/otherCatalogNumbers
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/otherCatalogNumbers-2026-05-26
Label Other Catalog Numbers
Definition A list (concatenated and separated) of previous or alternate fully qualified catalog numbers or other human-used identifiers for the same dwc:MaterialEntity, whether in the current or any other data set or collection.
Notes Recommended best practice is to separate the values in a list with space vertical bar space ( | ).
Examples
  • FMNH:Mammal:1234
  • NPS YELLO6778 | MBG 33424
ABCD equivalence DataSets/DataSet/Units/Unit/SpecimenUnit/History/PreviousUnitsText
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2014-10-30_16
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:ownerInstitutionCode
Term IRI http://rs.tdwg.org/dwc/terms/ownerInstitutionCode
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/ownerInstitutionCode-2026-05-26
Label Owner Institution Code
Definition A name (or acronym) in use by an institution having ownership of a resource.
Examples
  • NPS
  • APN
  • InBio
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:parentEventID
Term IRI http://rs.tdwg.org/dwc/terms/parentEventID
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/parentEventID-2026-05-26
Label Parent Event ID
Definition An identifier for a broader dwc:Event that contains this and potentially other dwc:Events.
Notes Recommended best practice is to use a globally unique identifier.
Examples A1 (parentEventID to identify the main Whittaker Plot in nested samples, each with its own eventID - A1:1, A1:2).
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2015-03-19_18
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:parentMeasurementID
Term IRI http://rs.tdwg.org/dwc/terms/parentMeasurementID
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/parentMeasurementID-2023-06-28
Label Parent Measurement ID
Definition An identifier for a broader dwc:MeasurementOrFact that groups this and potentially other dwc:MeasurementOrFacts.
Notes May be a globally unique identifier or an identifier specific to the data set.
Examples
  • 9c752d22-b09a-11e8-96f8-529269fb1459
  • E1_E1_O1_M1
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-06-28_40
Term Name dwc:parentNameUsage
Term IRI http://rs.tdwg.org/dwc/terms/parentNameUsage
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/parentNameUsage-2023-06-28
Label Parent Name Usage
Definition The full name, with authorship and date information if known, of the direct, most proximate higher-rank parent dwc:Taxon (in a classification) of the most specific element of the dwc:scientificName.
Examples
  • Rubiaceae
  • Gruiformes
  • Testudinae
ABCD equivalence DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/HigherTaxa/HigherTaxon/HigherTaxonName
Type Property
Term Name dwc:parentNameUsageID
Term IRI http://rs.tdwg.org/dwc/terms/parentNameUsageID
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/parentNameUsageID-2023-06-28
Label Parent Name Usage ID
Definition An identifier for the name usage (documented meaning of the name according to a source) of the direct, most proximate higher-rank parent taxon (in a classification) of the most specific element of the dwc:scientificName.
Notes This term should be used for accepted names to refer to the dwc:taxonID of a dwc:Taxon record that represents the next higher taxon rank in the same taxonomic classification. For Darwin Core Archives the related record should be present locally in the same archive.
Examples
  • tsn:41074 (ITIS)
  • urn:lsid:ipni.org:names:30001404-2 (IPNI)
  • 2704173 (GBIF)
  • 6T8N (COL)
ABCD equivalence not in ABCD
Type Property
Term Name dwciri:pathway
Term IRI http://rs.tdwg.org/dwc/iri/pathway
Modified 2025-07-10
Term version IRI http://rs.tdwg.org/dwc/iri/version/pathway-2025-07-10
Label Pathway (IRI)
Definition The process by which a dwc:Organism came to be in a given place at a given time.
Notes Recommended best practice is to use IRIs from the controlled vocabulary designated for use with this term, listed at http://rs.tdwg.org/dwc/doc/pw/. For details, refer to https://doi.org/10.3897/biss.3.38084 . Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2020-10-13_23
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-07-10_50
Term Name dwc:pathway
Term IRI http://rs.tdwg.org/dwc/terms/pathway
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/pathway-2023-06-28
Label Pathway
Definition The process by which a dwc:Organism came to be in a given place at a given time.
Notes Recommended best practice is to use controlled value strings from the controlled vocabulary designated for use with this term, listed at http://rs.tdwg.org/dwc/doc/pw/. For details, refer to https://doi.org/10.3897/biss.3.38084. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples
  • releasedForUse
  • otherEscape
  • transportContaminant
  • transportStowaway
  • corridor
  • unaided
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2020-10-13_23
Term Name dwc:phylum
Term IRI http://rs.tdwg.org/dwc/terms/phylum
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/phylum-2023-06-28
Label Phylum
Definition The full scientific name of the phylum or division in which the dwc:Taxon is classified.
Examples
  • Chordata (phylum)
  • Bryophyta (division)
ABCD equivalence DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/HigherTaxa/HigherTaxon/HigherTaxonName with HigherTaxa/HigherTaxon/HigherTaxonRank = phylum
Type Property
Term Name dwc:pointRadiusSpatialFit
Term IRI http://rs.tdwg.org/dwc/terms/pointRadiusSpatialFit
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/pointRadiusSpatialFit-2026-05-26
Label Point Radius Spatial Fit
Definition A ratio of the area of a point-radius (dwc:decimalLatitude, dwc:decimalLongitude, dwc:coordinateUncertaintyInMeters) to the area of a true (original, or most specific) spatial representation of a dcterms:Location.
Notes Legal values are 0, greater than or equal to 1, or undefined. A value of 1 is an exact match or 100% overlap. A value of 0 should be used if the given point-radius does not completely contain the original representation. The pointRadiusSpatialFit is undefined (and should be left empty) if the original representation is any geometry without area (e.g., a point or polyline) and without uncertainty and the given georeference is not that same geometry (without uncertainty). If both the original and the given georeference are the same point, the pointRadiusSpatialFit is 1. Detailed explanations with graphical examples can be found in the Georeferencing Best Practices, Chapman and Wieczorek, 2020 (https://doi.org/10.15468/doc-gg7h-s853).
Examples
  • 0
  • 1
  • 1.5708
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/PointRadiusSpatialFit
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-06-28_40
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:preferredSpatialRepresentation
Term IRI http://rs.tdwg.org/dwc/terms/preferredSpatialRepresentation
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/preferredSpatialRepresentation-2026-05-26
Label Preferred Spatial Representation
Definition An indication of which spatial representation best represents the dcterms:Location.
Examples
  • point-radius
  • footprint
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwciri:preferredSpatialRepresentation
Term IRI http://rs.tdwg.org/dwc/iri/preferredSpatialRepresentation
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/iri/version/preferredSpatialRepresentation-2026-05-26
Label Preferred Spatial Representation (IRI)
Definition An indication of which spatial representation best represents the dcterms:Location.
Notes Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:preparations
Term IRI http://rs.tdwg.org/dwc/terms/preparations
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/preparations-2026-05-26
Label Preparations
Definition A list (concatenated and separated) of preparations and preservation methods for a dwc:MaterialEntity.
Notes Recommended best practice is to separate the values in a list with space vertical bar space ( | ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples
  • fossil
  • cast
  • photograph
  • DNA extract
  • skin | skull | skeleton
  • whole animal (EtOH) | tissue (EDTA)
ABCD equivalence DataSets/DataSet/Units/Unit/SpecimenUnit/Preparations/PreparationsText
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2014-10-30_16
Executive Committee decision http://rs.tdwg.org/decisions/decision-2019-12-01_19
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-09-13_41
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-06-12_44
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwciri:preparations
Term IRI http://rs.tdwg.org/dwc/iri/preparations
Modified 2025-07-10
Term version IRI http://rs.tdwg.org/dwc/iri/version/preparations-2025-07-10
Label Preparations (IRI)
Definition A preparation or preservation method for a specimen.
Notes Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-07-10_50
Term Name dwc:PreservedSpecimen
Term IRI http://rs.tdwg.org/dwc/terms/PreservedSpecimen
Modified 2023-09-18
Term version IRI http://rs.tdwg.org/dwc/terms/version/PreservedSpecimen-2023-09-18
Label Preserved Specimen
Definition A specimen that has been preserved.
Examples
  • a plant on an herbarium sheet
  • a cataloged lot of fish in a jar
ABCD equivalence RecordBasisEnum/PreservedSpecimen
Type Class
Executive Committee decision http://rs.tdwg.org/decisions/decision-2014-10-26_15
Term Name dwc:PreviousIdentifications
Term IRI http://rs.tdwg.org/dwc/terms/PreviousIdentifications
Modified 2009-04-24
Label Previous Identifications
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/previousIdentifications
Definition A list (concatenated and separated) of previous ScientificNames to which the sample was identified.
Notes Example: "Anthus correndera".
ABCD equivalence DataSets/DataSet/Units/Unit/Identifications/Identification with PreferredFlag = false
Type Property
Term Name dwc:previousIdentifications
Term IRI http://rs.tdwg.org/dwc/terms/previousIdentifications
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/previousIdentifications-2023-06-28
Label Previous Identifications
Definition A list (concatenated and separated) of previous assignments of names to the dwc:Organism.
Notes Recommended best practice is to separate the values in a list with space vertical bar space ( | ).
Examples
  • Chalepidae
  • Pinus abies
  • Anthus sp., field ID by G. Iglesias | Anthus correndera, expert ID by C. Cicero 2009-02-12 based on morphology
ABCD equivalence DataSets/DataSet/Units/Unit/Identifications/Identification with PreferredFlag = false
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2014-10-26_14
Executive Committee decision http://rs.tdwg.org/decisions/decision-2014-10-30_16
Term Name dwc:processedTotalReadCount
Term IRI http://rs.tdwg.org/dwc/terms/processedTotalReadCount
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/processedTotalReadCount-2026-05-26
Label Processed Total Read Count
Definition The total number of reads obtained for a processed dwc:NucleotideSequence during a dwc:NucleotideAnalysis.
Examples 50638, 345987, 764032
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:projectID
Term IRI http://rs.tdwg.org/dwc/terms/projectID
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/projectID-2026-05-26
Label Project ID
Definition A list (concatenated and separated) of identifiers for projects that contributed to a dwc:Event.
Notes A projectID may be shared in multiple distinct datasets. The nature of the association can be described in the metadata project description element. This term should be used to provide a globally unique identifier (GUID) for a project, if available. This could be a DOI, URI, or any other persistent identifier that ensures a project can be uniquely distinguished from others. The Recommended best practice is to separate the values in a list with space vertical bar space ( | ).
Examples
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-06-12_44
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:projectTitle
Term IRI http://rs.tdwg.org/dwc/terms/projectTitle
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/projectTitle-2026-05-26
Label Project Title
Definition A list (concatenated and separated) of titles or names for projects that contributed to a dwc:Event.
Notes Use this term to provide the official name or title of a project as it is commonly known and cited. Avoid abbreviations unless they are widely understood. The recommended best practice is to separate the values in a list with space vertical bar space ( | ).
Examples
  • Arctic Deep
  • Scalidophora i Noreg
  • The Nansen Legacy
  • Underwater Oases of the Mar del Plata Canyon: Talud Continental IV
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/Project/ProjectTitle
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-06-12_44
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:Protocol
Term IRI http://rs.tdwg.org/dwc/terms/Protocol
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/Protocol-2026-05-26
Label Protocol
Definition A method used during an action.
Examples
  • a pitfall trap method for sampling ground-dwelling arthropods
  • a point-radius georeferencing method
  • a linear regression model to estimate body mass from skeletal measurements
  • a Bayesian phylogenetic inference method
ABCD equivalence not in ABCD
Type Class
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:protocolDescription
Term IRI http://rs.tdwg.org/dwc/terms/protocolDescription
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/protocolDescription-2026-05-26
Label Protocol Description
Definition A detailed description of a dwc:Protocol.
Examples Georeference following Zermoglio et al. 2020 (https://doi.org/10.35035/e09p-h128), using GeoPick (https://geopick.gbif.org/) for named place determinations and Georeferencing Calculator (https://github.com/VertNet/georefcalculator) for complex uncertainties.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:protocolID
Term IRI http://rs.tdwg.org/dwc/terms/protocolID
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/protocolID-2026-05-26
Label Protocol ID
Definition An identifier for a dwc:Protocol.
Notes Recommended best practice is to use a globally unique identifier.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:protocolReferences
Term IRI http://rs.tdwg.org/dwc/terms/protocolReferences
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/protocolReferences-2026-05-26
Label Protocol References
Definition A list (concatenated and separated) of dcterms:BibliographicResources used in a dwc:Protocol.
Notes Recommended best practice is to separate multiple values in a list with space vertical bar space ( | ).
Examples Penguins from space: faecal stains reveal the location of emperor penguin colonies, https://doi.org/10.1111/j.1466-8238.2009.00467.x
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:protocolRemarks
Term IRI http://rs.tdwg.org/dwc/terms/protocolRemarks
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/protocolRemarks-2026-05-26
Label Protocol Remarks
Definition Comments or notes about a dwc:Protocol.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:protocolType
Term IRI http://rs.tdwg.org/dwc/terms/protocolType
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/protocolType-2026-05-26
Label Protocol Type
Definition A category that best matches the nature of a dwc:Protocol.
Notes Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples
  • measurement
  • georeference
  • chronometricAge
  • chronometricAgeConversion
  • samplingEffort
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwciri:protocolType
Term IRI http://rs.tdwg.org/dwc/iri/protocolType
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/iri/version/protocolType-2026-05-26
Label Protocol Type (IRI)
Definition A category that best matches the nature of a dwc:Protocol.
Notes Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:Provenance
Term IRI http://rs.tdwg.org/dwc/terms/Provenance
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/Provenance-2026-05-26
Label Provenance
Definition Information about an entity’s origins.
Notes This is a convenience class to group related properties.
ABCD equivalence not in ABCD
Type Class
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:readCount
Term IRI http://rs.tdwg.org/dwc/terms/readCount
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/readCount-2026-05-26
Label Read Count
Definition The number of reads obtained for a processed dwc:NucleotideSequence during a dwc:NucleotideAnalysis.
Examples
  • 325
  • 73591
  • 8302
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:recordedBy
Term IRI http://rs.tdwg.org/dwc/terms/recordedBy
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/recordedBy-2026-05-26
Label Recorded By
Definition A name for a dcterms:Agent responsible for recording a dwc:Occurrence.
Notes Recommended best practice is to separate the values in a list with space vertical bar space ( | ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples
  • José E. Crespo
  • Oliver P. Pearson | Anita K. Pearson
  • Megatherium Club
  • The Natural History Society of Northumbria
  • ROV SuBastian
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/GatheringAgents/GatheringAgentsText
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2014-10-30_16
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwciri:recordedBy
Term IRI http://rs.tdwg.org/dwc/iri/recordedBy
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/iri/version/recordedBy-2026-05-26
Label Recorded By (IRI)
Definition An IRI identifying a dcterms:Agent responsible for recording a dwc:Occurrence.
Notes Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-07-10_50
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:recordedByID
Term IRI http://rs.tdwg.org/dwc/terms/recordedByID
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/recordedByID-2026-05-26
Label Recorded By ID
Definition An identifier for a dcterms:Agent responsible for recording a dwc:Occurrence.
Notes Recommended best practice is to separate the values in a list with space vertical bar space ( | ).
Examples
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2021-07-15_34
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwciri:recordNumber
Term IRI http://rs.tdwg.org/dwc/iri/recordNumber
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/iri/version/recordNumber-2023-06-28
Label Record Number (IRI)
Definition An identifier given to the dwc:Occurrence at the time it was recorded. Often serves as a link between field notes and a dwc:Occurrence record, such as a specimen collector's number.
Notes The subject is a dwc:Occurrence and the object is a (possibly IRI-identified) resource that is the field notes.
ABCD equivalence not in ABCD
Type Property
Term Name dwc:recordNumber
Term IRI http://rs.tdwg.org/dwc/terms/recordNumber
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/recordNumber-2023-06-28
Label Record Number
Definition An identifier given to the dwc:Occurrence at the time it was recorded. Often serves as a link between field notes and a dwc:Occurrence record, such as a specimen collector's number.
Notes This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples OPP 7101
ABCD equivalence DataSets/DataSet/Units/Unit/CollectorsFieldNumber
Type Property
Term Name dwc:referenceID
Term IRI http://rs.tdwg.org/dwc/terms/referenceID
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/referenceID-2026-05-26
Label Reference ID
Definition An identifier for a dcterms:BibliographicResource.
Notes Recommended best practice is to use a globally unique identifier.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:referenceRemarks
Term IRI http://rs.tdwg.org/dwc/terms/referenceRemarks
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/referenceRemarks-2026-05-26
Label Reference Remarks
Definition Comments or notes about a dcterms:BibliographicResource.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dcterms:references
Term IRI http://purl.org/dc/terms/references
Modified 2026-05-26
Term version IRI http://dublincore.org/usage/terms/history/#references-003
Label References
Definition A related resource that is referenced, cited, or otherwise pointed to by the described resource.
Notes From Dublin Core, "This property is intended to be used with non-literal values. This property is an inverse property of Is Referenced By." The intended usage of this term in Darwin Core is to point to the definitive source representation of the resource (e.g., dwc:Taxon, dwc:Occurrence, dwc:Event), if one is available. Note that the intended usage of dcterms:bibliographicCitation in Darwin Core, by contrast, is to provide the preferred way to cite the resource itself.
Examples
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2011-10-16_7
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-09-13_41
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:referenceType
Term IRI http://rs.tdwg.org/dwc/terms/referenceType
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/referenceType-2026-05-26
Label Reference Type
Definition A category that best matches the nature of a dcterms:BibliographicResource.
Notes Recommended best practice is to use a controlled vocabulary.
Examples
  • book, bookSection, journalArticle, thesis
  • proceedingsPaper
  • report
  • poster
  • fieldNotebook
  • log
  • oralCommunication
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:RelatedBasisOfRecord
Term IRI http://rs.tdwg.org/dwc/terms/RelatedBasisOfRecord
Modified 2009-01-26
Label Related Basis of Record
This term is deprecated and should no longer be used.
Definition The nature of the related resource. Recommended best practice is to use the same controlled vocabulary as for basisOfRecord.
Notes Example: "PreservedSpecimen"
ABCD equivalence not in ABCD
Type Property
Term Name dwc:relatedResourceID
Term IRI http://rs.tdwg.org/dwc/terms/relatedResourceID
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/relatedResourceID-2026-05-26
Label Related Resource ID
Definition An identifier for the related resource (the object) of a dwc:ResourceRelationship.
Notes Recommended best practice is to use a globally unique identifier.
Examples dc609808-b09b-11e8-96f8-529269fb1459
ABCD equivalence DataSets/DataSet/Units/Unit/Associations/UnitAssociation/AssociatedUnitSourceInstitutionCode + DataSets/DataSet/Units/Unit/Associations/UnitAssociation/AssociatedUnitSourceName + DataSets/DataSet/Units/Unit/Associations/UnitAssociation/AssociatedUnitID
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2024-02-28_43
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:relatedResourceType
Term IRI http://rs.tdwg.org/dwc/terms/relatedResourceType
Modified 2009-10-09
Label Related Resource Type
This term is deprecated and should no longer be used.
Definition The type of the related resource. Recommended best practice is to use a controlled vocabulary.
Notes Examples: "StillImage", "MovingImage", "Sound", PhysicalObject", "PreservedSpecimen", FossilSpecimen", LivingSpecimen", "HumanObservation", "MachineObservation", "Location", "Taxonomy", "NomeclaturalChecklist", "Publication"
ABCD equivalence not in ABCD
Type Property
Term Name dwc:relationshipAccordingTo
Term IRI http://rs.tdwg.org/dwc/terms/relationshipAccordingTo
Modified 2018-09-06
Term version IRI http://rs.tdwg.org/dwc/terms/version/relationshipAccordingTo-2018-09-06
Label Relationship According To
Definition The source (person, organization, publication, reference) establishing the relationship between the two resources.
Examples Julie Woodruff
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2024-02-28_43
Term Name dwc:relationshipEstablishedDate
Term IRI http://rs.tdwg.org/dwc/terms/relationshipEstablishedDate
Modified 2025-06-12
Term version IRI http://rs.tdwg.org/dwc/terms/version/relationshipEstablishedDate-2025-06-12
Label Relationship Established Date
Definition The date-time on which the relationship between the two resources was established.
Notes Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples
  • 1963-03-08T14:07-06:00 (8 Mar 1963 at or after 2:07pm and before 2:08pm in the time zone six hours earlier than UTC)
  • 2009-02-20T08:40Z (20 February 2009 at or after 8:40am and before 8:41 UTC)
  • 2018-08-29T15:19 (29 August 2018 at or after 3:19pm and before 3:20pm local time)
  • 1809-02-12 (within the day 12 February 1809)
  • 1906-06 (in the month of June 1906)
  • 1971 (in the year 1971)
  • 2007-03-01T13:00:00Z/2008-05-11T15:30:00Z (some time within the interval beginning 1 March 2007 at 1pm UTC and before 11 May 2008 at 3:30pm UTC)
  • 1900/1909 (some time within the interval between the beginning of the year 1900 and before the year 1909)
  • 2007-11-13/15 (some time in the interval between the beginning of 13 November 2007 and before 15 November 2007)
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2024-02-28_43
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-06-12_44
Term Name dwc:relationshipOfResource
Term IRI http://rs.tdwg.org/dwc/terms/relationshipOfResource
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/relationshipOfResource-2023-06-28
Label Relationship Of Resource
Definition The relationship of the subject (identified by dwc:resourceID) to the object (identified by dwc:relatedResourceID).
Notes Recommended best practice is to use a controlled vocabulary.
Examples
  • same as
  • duplicate of
  • mother of
  • offspring of
  • sibling of
  • parasite of
  • host of
  • valid synonym of
  • located within
  • pollinator of members of taxon
  • pollinated specific plant
  • pollinated by members of taxon
  • on slab with
ABCD equivalence DataSets/DataSet/Units/Unit/Associations/UnitAssociation/AssociationType
Type Property
Term Name dwc:relationshipOfResourceID
Term IRI http://rs.tdwg.org/dwc/terms/relationshipOfResourceID
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/relationshipOfResourceID-2023-06-28
Label Relationship Of Resource ID
Definition An identifier for the relationship type (predicate) that connects the subject identified by dwc:resourceID to its object identified by dwc:relatedResourceID.
Notes Recommended best practice is to use the identifiers of the terms in a controlled vocabulary, such as the OBO Relation Ontology.
Examples
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2021-07-15_34
Term Name dwc:relationshipRemarks
Term IRI http://rs.tdwg.org/dwc/terms/relationshipRemarks
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/relationshipRemarks-2023-06-28
Label Relationship Remarks
Definition Comments or notes about the relationship between the two resources.
Examples
  • mother and offspring collected from the same nest
  • pollinator captured in the act
ABCD equivalence DataSets/DataSet/Units/Unit/Associations/UnitAssociation/Comments
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2024-02-28_43
Term Name dwciri:reproductiveCondition
Term IRI http://rs.tdwg.org/dwc/iri/reproductiveCondition
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/iri/version/reproductiveCondition-2026-05-26
Label Reproductive Condition (IRI)
Definition A reproductive condition of a dwc:Organism.
Notes Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-07-10_50
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:reproductiveCondition
Term IRI http://rs.tdwg.org/dwc/terms/reproductiveCondition
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/reproductiveCondition-2026-05-26
Label Reproductive Condition
Definition A reproductive condition of a dwc:Organism.
Notes Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples
  • non-reproductive
  • pregnant
  • in bloom
  • fruit-bearing
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:resourceID
Term IRI http://rs.tdwg.org/dwc/terms/resourceID
Modified 2018-09-06
Term version IRI http://rs.tdwg.org/dwc/terms/version/resourceID-2018-09-06
Label Resource ID
Definition An identifier for the resource that is the subject of the relationship.
Examples f809b9e0-b09b-11e8-96f8-529269fb1459
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2024-02-28_43
Term Name dwc:ResourceRelationship
Term IRI http://rs.tdwg.org/dwc/terms/ResourceRelationship
Modified 2023-09-13
Term version IRI http://rs.tdwg.org/dwc/terms/version/ResourceRelationship-2023-09-13
Label Resource Relationship
Definition A relationship of one rdfs:Resource (http://www.w3.org/2000/01/rdf-schema#Resource) to another.
Notes Resources can be thought of as identifiable records or instances of classes and may include, but need not be limited to instances of dwc:Occurrence, dwc:Organism, dwc:MaterialEntity, dwc:Event, dcterms:Location, dwc:GeologicalContext, dwc:Identification, or dwc:Taxon.
Examples
  • an instance of a dwc:Organism is the mother of another instance of a dwc:Organism
  • a uniquely identified dwc:Occurrence represents the same dwc:Occurrence as another uniquely identified dwc:Occurrence
  • a dwc:MaterialEntity is a subsample of another dwc:MaterialEntity
ABCD equivalence DataSets/DataSet/Units/Unit/Associations
Type Class
Executive Committee decision http://rs.tdwg.org/decisions/decision-2014-10-26_15
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-09-13_41
Term Name dwc:resourceRelationshipID
Term IRI http://rs.tdwg.org/dwc/terms/resourceRelationshipID
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/resourceRelationshipID-2026-05-26
Label Resource Relationship ID
Definition An identifier for a dwc:ResourceRelationship.
Notes Recommended best practice is to use a globally unique identifier.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dcterms:rights
Term IRI http://purl.org/dc/terms/rights
Modified 2008-01-14
Label Rights
This term is deprecated and should no longer be used.
Is replaced by http://purl.org/dc/terms/license
Definition Information about rights held in and over the resource.
Notes Typically, rights information includes a statement about various property rights associated with the resource, including intellectual property rights.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2014-11-06_17
Executive Committee decision http://rs.tdwg.org/decisions/decision-2019-12-01_19
Executive Committee decision http://rs.tdwg.org/decisions/decision-2024-02-28_43
Term Name dcterms:rightsHolder
Term IRI http://purl.org/dc/terms/rightsHolder
Modified 2008-01-14
Term version IRI http://dublincore.org/usage/terms/history/#rightsHolder-002
Label Rights Holder
Definition A person or organization owning or managing rights over the resource.
Examples The Regents of the University of California
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2024-02-28_43
Term Name dwc:Sample
Term IRI http://rs.tdwg.org/dwc/terms/Sample
Modified 2009-04-29
Label Sample
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/Occurrence
Definition Container class for information about the results of a sampling event (specimen, observation, etc.)
ABCD equivalence DataSets/DataSet/Units/Unit
Type Class
Term Name dwc:SampleAttribute
Term IRI http://rs.tdwg.org/dwc/terms/SampleAttribute
Modified 2009-04-29
Label Sample Attribute
This term is deprecated and should no longer be used.
Definition Container class for information about attributes related to a given sample.
ABCD equivalence Datasets/Dataset/Units/Unit/MeasurementsOrFacts
Type Class
Term Name dwc:SampleAttributeAccuracy
Term IRI http://rs.tdwg.org/dwc/terms/SampleAttributeAccuracy
Modified 2009-04-29
Label Sample Attribute Accuracy
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/occurrenceMeasurementAccuracy
Definition The description of the error associated with the SampleAttributeValue.
Notes Example: "0.01", "normal distribution with variation of 2 m"
ABCD equivalence DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Accuracy
Type Property
Term Name dwc:SampleAttributeDeterminedBy
Term IRI http://rs.tdwg.org/dwc/terms/SampleAttributeDeterminedBy
Modified 2009-04-29
Label Sample Attribute Determined By
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/occurrenceMeasurementDeterminedBy
Definition The agent responsible for having determined the value of the measurement or characteristic of the sample.
Notes Example: "Javier de la Torre"
ABCD equivalence DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/MeasuredBy
Type Property
Term Name dwc:SampleAttributeDeterminedDate
Term IRI http://rs.tdwg.org/dwc/terms/SampleAttributeDeterminedDate
Modified 2009-04-29
Label Sample Attribute Determined Date
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/occurrenceMeasurementDeterminedDate
Definition The date on which the the measurement or characteristic of the sample was made.
Notes Date may be used to express temporal information at any level of granularity. Recommended best practice is to use an encoding scheme, such as the W3CDTF profile of ISO 8601 [W3CDTF].
ABCD equivalence DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/MeasurementDateTime
Type Property
Term Name dwc:SampleAttributeRemarks
Term IRI http://rs.tdwg.org/dwc/terms/SampleAttributeRemarks
Modified 2009-04-29
Label Sample Attribute Remarks
This term is deprecated and should no longer be used.
Definition Comments or notes accompanying the measurement or characteristic of the sample.
Notes Example: "tip of tail missing"
ABCD equivalence not in ABCD
Type Property
Term Name dwc:SampleAttributeUnit
Term IRI http://rs.tdwg.org/dwc/terms/SampleAttributeUnit
Modified 2009-04-29
Label Sample Attribute Unit
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/occurrenceMeasurementUnit
Definition The units for the value of the measurement or characteristic of the sample. Recommended best practice is to use International System of Units (SI) units.
Notes Example: "mm"
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UnitOfMeasurement
Type Property
Term Name dwc:SampleAttributeValue
Term IRI http://rs.tdwg.org/dwc/terms/SampleAttributeValue
Modified 2009-04-29
Label Sample Attribute Value
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/occurrenceMeasurementValue
Definition The value of the measurement or characteristic of the sample.
Notes Example: "45"
ABCD equivalence DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UpperValue
Type Property
Term Name dwciri:sampledSubstrateCategory
Term IRI http://rs.tdwg.org/dwc/iri/sampledSubstrateCategory
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/iri/version/sampledSubstrateCategory-2026-05-26
Label Sampled Substrate Category (IRI)
Definition A category or type of substrate sampled during a dwc:Event.
Notes Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:sampledSubstrateCategory
Term IRI http://rs.tdwg.org/dwc/terms/sampledSubstrateCategory
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/sampledSubstrateCategory-2026-05-26
Label Sampled Substrate Category
Definition A category or type of substrate sampled during a dwc:Event.
Notes Recommended best practice is to use a controlled vocabulary and separate the values in a list with space vertical bar space ( | ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples
  • vegetation
  • soil
  • ocean
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:sampledSubstrateLayer
Term IRI http://rs.tdwg.org/dwc/terms/sampledSubstrateLayer
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/sampledSubstrateLayer-2026-05-26
Label Sampled Substrate Layer
Definition A list (concatenated and separated) of substrate layers sampled during a dwc:Event.
Notes Recommended best practice is to use a controlled vocabulary and separate the values in a list with space vertical bar space ( | ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples
  • forest floor
  • herbaceous | shrub
  • understory
  • canopy
  • organic (O)
  • surface (A)
  • eluviated (E)
  • subsoil (B)
  • parent material (C)
  • bedrock (R)
  • epipelagic | mesopelagic
  • bathypelagic
  • abysopelagic
  • hadalpelagic
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwciri:sampledSubstrateLayer
Term IRI http://rs.tdwg.org/dwc/iri/sampledSubstrateLayer
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/iri/version/sampledSubstrateLayer-2026-05-26
Label Sampled Substrate Layer (IRI)
Definition An IRI identifying a substrate layer sampled during a dwc:Event.
Notes Recommended best practice is describe a dwc:Event with no more than one sampled substrate layer. In the case of a dwc:Event that cannot be attributed to a specific layer, the recommended best practice is to repeat the property for each IRI that denotes a different layer that applies to the dwc:Event. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:SampleRemarks
Term IRI http://rs.tdwg.org/dwc/terms/SampleRemarks
Modified 2009-04-29
Label Sample Remarks
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/occurrenceRemarks
Definition Comments or notes about the sample or record.
Notes Example: "found dead on road"
ABCD equivalence DataSets/DataSet/Units/Unit/Notes
Type Property
Term Name dwc:sampleSizeUnit
Term IRI http://rs.tdwg.org/dwc/terms/sampleSizeUnit
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/sampleSizeUnit-2023-06-28
Label Sample Size Unit
Definition The unit of measurement of the size (time duration, length, area, or volume) of a sample in a sampling dwc:Event.
Notes A dwc:sampleSizeUnit must have a corresponding dwc:sampleSizeValue, e.g., 5 for dwc:sampleSizeValue with m for dwc:sampleSizeUnit. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples
  • minute
  • hour
  • day
  • metre
  • square metre
  • cubic metre
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2015-03-19_18
Term Name dwciri:sampleSizeUnit
Term IRI http://rs.tdwg.org/dwc/iri/sampleSizeUnit
Modified 2025-07-10
Term version IRI http://rs.tdwg.org/dwc/iri/version/sampleSizeUnit-2025-07-10
Label Sampling Size Unit (IRI)
Definition The unit of measurement of the size (time duration, length, area, or volume) of a sample in a sampling dwc:Event.
Notes A dwciri:sampleSizeUnit must have a corresponding dwc:sampleSizeValue. Recommended best practice is to use a controlled vocabulary such as the Ontology of Units of Measure http://www.wurvoc.org/vocabularies/om-1.8/ of SI units, derived units, or other non-SI units accepted for use within the SI.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-07-10_50
Term Name dwc:sampleSizeValue
Term IRI http://rs.tdwg.org/dwc/terms/sampleSizeValue
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/sampleSizeValue-2023-06-28
Label Sample Size Value
Definition A numeric value for a measurement of the size (time duration, length, area, or volume) of a sample in a sampling dwc:Event.
Notes A dwc:sampleSizeValue must have a corresponding dwc:sampleSizeUnit.
Examples 5 (sampleSizeValue) with metre (sampleSizeUnit)
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2015-03-19_18
Term Name dwc:SamplingAttributeID
Term IRI http://rs.tdwg.org/dwc/terms/SamplingAttributeID
Modified 2009-04-29
Label Sample Attribute ID
This term is deprecated and should no longer be used.
Definition An identifier for the sampling attribute. May be a global unique identifier or an identifier specific to the data set.
ABCD equivalence not in ABCD
Type Property
Term Name dwc:SamplingAttributeType
Term IRI http://rs.tdwg.org/dwc/terms/SamplingAttributeType
Modified 2009-04-29
Label Sample Attribute Type
This term is deprecated and should no longer be used.
Definition The nature of the measurement or characteristic of the sample. Recommended best practice is to use a controlled vocabulary.
Notes Example: "tail length"
ABCD equivalence DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Parameter
Type Property
Term Name dwc:samplingEffort
Term IRI http://rs.tdwg.org/dwc/terms/samplingEffort
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/samplingEffort-2023-06-28
Label Sampling Effort
Definition The amount of effort expended during a dwc:Event.
Examples
  • 40 trap-nights
  • 10 observer-hours
  • 10 km by foot
  • 30 km by car
ABCD equivalence not in ABCD
Type Property
Term Name dwc:SamplingEvent
Term IRI http://rs.tdwg.org/dwc/terms/SamplingEvent
Modified 2009-04-29
Label Sampling Event
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/Event
Definition Container class for information about the conditions and methods of acquisition of samples.
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering
Type Class
Term Name dwc:SamplingEventAttributes
Term IRI http://rs.tdwg.org/dwc/terms/SamplingEventAttributes
Modified 2009-04-29
Label Sampling Event Attributes
This term is deprecated and should no longer be used.
Definition A list (concatenated and separated) of additional measurements or characteristics of the sampling event.
Notes Example: "Relative humidity: 28 %; Temperature: 22 C; Sample size: 10 kg"
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts
Type Property
Term Name dwc:SamplingEventID
Term IRI http://rs.tdwg.org/dwc/terms/SamplingEventID
Modified 2009-04-29
Label Sampling Event ID
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/eventID
Definition An identifier for the sampling event. May be a global unique identifier or an identifier specific to the data set.
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/Code
Type Property
Term Name dwc:SamplingEventRemarks
Term IRI http://rs.tdwg.org/dwc/terms/SamplingEventRemarks
Modified 2009-04-29
Label Sampling Event Remarks
This term is deprecated and should no longer be used.
Definition Comments or notes about the sampling event.
Notes Example: "found dead on road"
ABCD equivalence not in ABCD
Type Property
Term Name dwc:SamplingLocation
Term IRI http://rs.tdwg.org/dwc/terms/SamplingLocation
Modified 2009-04-29
Label Sampling Location
This term is deprecated and should no longer be used.
Definition Container class for information about the location where a sampling event occurred.
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/LocalityText
Type Class
Term Name dwc:SamplingLocationID
Term IRI http://rs.tdwg.org/dwc/terms/SamplingLocationID
Modified 2009-04-29
Label Sampling Location ID
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/locationID
Definition An identifier for the sampling location. May be a global unique identifier or an identifier specific to the data set.
Notes Example: "MVZ:LocID:12345"
ABCD equivalence not in ABCD
Type Property
Term Name dwc:SamplingLocationRemarks
Term IRI http://rs.tdwg.org/dwc/terms/SamplingLocationRemarks
Modified 2009-04-29
Label Sampling Location Remarks
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/locationRemarks
Definition Comments or notes about the sampling location.
Notes Example: "under water since 2005"
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/AreaDetail
Type Property
Term Name dwc:samplingProtocol
Term IRI http://rs.tdwg.org/dwc/terms/samplingProtocol
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/samplingProtocol-2026-05-26
Label Sampling Protocol
Definition The names of, references to, or descriptions of the methods or protocols used during a dwc:Event.
Notes Recommended best practice is to describe a dwc:Event with no more than one sampling protocol. In the case of a summary Event with multiple protocols, in which a specific protocol can not be attributed to specific dwc:Occurrences, the recommended best practice is to separate the values in a list with space vertical bar space ( | ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/Method
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2021-07-15_34
Executive Committee decision http://rs.tdwg.org/decisions/decision-2024-02-28_43
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwciri:samplingProtocol
Term IRI http://rs.tdwg.org/dwc/iri/samplingProtocol
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/iri/version/samplingProtocol-2026-05-26
Label Sampling Protocol (IRI)
Definition The methods or protocols used during a dwc:Event, denoted by an IRI.
Notes Recommended best practice is to describe a dwc:Event with no more than one sampling protocol. In the case of a summary dwc:Event in which a specific protocol can not be attributed to specific dwc:Occurrences, the recommended best practice is to repeat the property for each IRI that denotes a different sampling protocol that applies to the dwc:Occurrence.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2021-07-15_34
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:scientificName
Term IRI http://rs.tdwg.org/dwc/terms/scientificName
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/scientificName-2026-05-26
Label Scientific Name
Definition The full scientific name, with authorship and date information if known. When forming part of a dwc:Identification, this should be the name in lowest level taxonomic rank that can be determined.
Notes This term should not contain identification qualifications, which should instead be supplied in the IdentificationQualifier term. When applied to an Organism or Occurrence, this term should be used to represent the scientific name that was applied to the associated Organism in accordance with the Taxon to which it was or is currently identified. Names should be compliant to the most recent nomenclatural code. For example, names of hybrids for algae, fungi and plants should follow the rules of the International Code of Nomenclature for algae, fungi, and plants (Shenzhen Code Articles H.1, H.2 and H.3). Thus, use the multiplication sign × (Unicode U+00D7, HTML ×) to identify a hybrid, not x or X, if possible.
Examples
  • Coleoptera (order)
  • Vespertilionidae (family)
  • Manis (genus)
  • Ctenomys sociabilis (genus + specificEpithet)
  • Ambystoma tigrinum diaboli (genus + specificEpithet + infraspecificEpithet)
  • Roptrocerus typographi (Györfi, 1952) (genus + specificEpithet + scientificNameAuthorship)
  • Quercus agrifolia var. oxyadenia (Torr.) J.T. Howell (genus + specificEpithet + taxonRank + infraspecificEpithet + scientificNameAuthorship)
  • ×Agropogon littoralis (Sm.) C. E. Hubb.
  • Mentha ×smithiana R. A. Graham
  • Agrostis stolonifera L. × Polypogon monspeliensis (L.) Desf.
ABCD equivalence DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/FullScientificNameString
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2019-12-01_19
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-06-28_40
Executive Committee decision http://rs.tdwg.org/decisions/decision-2024-02-28_43
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:scientificNameAuthorship
Term IRI http://rs.tdwg.org/dwc/terms/scientificNameAuthorship
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/scientificNameAuthorship-2023-06-28
Label Scientific Name Authorship
Definition The authorship information for the dwc:scientificName formatted according to the conventions of the applicable dwc:nomenclaturalCode.
Examples
  • (Torr.) J.T. Howell
  • (Martinovský) Tzvelev
  • (Györfi, 1952)
ABCD equivalence {DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Bacterial/ParentheticalAuthorTeamAndYear + DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Bacterial/AuthorTeamAndYear} or {DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Botanical/AuthorTeamParenthesis + DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Botanical/AuthorTeam} or {DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Zoological/AuthorTeamOriginalAndYear + [= or] DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Zoological/AuthorTeamParenthesisAndYear}
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-12-11_54
Term Name dwc:scientificNameID
Term IRI http://rs.tdwg.org/dwc/terms/scientificNameID
Modified 2017-10-06
Term version IRI http://rs.tdwg.org/dwc/terms/version/scientificNameID-2017-10-06
Label Scientific Name ID
Definition An identifier for the nomenclatural (not taxonomic) details of a scientific name.
Examples urn:lsid:ipni.org:names:37829-1:1.3
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2019-12-01_19
Term Name dwc:scientificNameRank
Term IRI http://rs.tdwg.org/dwc/terms/scientificNameRank
Modified 2009-09-21
Label Scientific Name Rank
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/taxonRank
Definition The taxonomic rank of the most specific name in the scientificName. Recommended best practice is to use a controlled vocabulary.
Notes Examples: "subsp.", "var.", "forma", "species", "genus"
ABCD equivalence DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Botanical/Rank
Type Property
Term Name dwc:sequence
Term IRI http://rs.tdwg.org/dwc/terms/sequence
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/sequence-2026-05-26
Label Sequence
Definition A string representing nucleotide base pairs.
Notes Recommended best practice is to use IUPAC single character symbols (https://www.bioinformatics.org/sms/iupac.html). Use "N" for an unknown or missing nucleotide, and avoid using "?". The sequence should be written in the 5' to 3' direction.
Examples TCTATCCTCAATTATAGGTCATAATTCACCATCAG
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:sex
Term IRI http://rs.tdwg.org/dwc/terms/sex
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/sex-2026-05-26
Label Sex
Definition A sex of a dwc:Organism.
Notes Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples
  • female
  • male
  • hermaphrodite
ABCD equivalence DataSets/DataSet/Units/Unit/Sex
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2019-12-01_19
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-02-24_55
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwciri:sex
Term IRI http://rs.tdwg.org/dwc/iri/sex
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/iri/version/sex-2026-05-26
Label Sex (IRI)
Definition A sex of a dwc:Organism.
Notes Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-07-10_50
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwciri:siteNumber
Term IRI http://rs.tdwg.org/dwc/iri/siteNumber
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/iri/version/siteNumber-2026-05-26
Label Site Number (IRI)
Definition An identifier for a named site.
Notes Usually an institutional identifier for a specific named place as opposed to dwc:locationID, which is an identifier for the entire set of distinct information for an instance of dcterms:Location. This term differs from dwciri:fieldNumber in that dwciri:siteNumber is not related strictly to one dwc:Event. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:siteNumber
Term IRI http://rs.tdwg.org/dwc/terms/siteNumber
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/siteNumber-2026-05-26
Label Site Number
Definition An identifier for a named site.
Notes Usually an institutional identifier for a specific named place as opposed to dwc:locationID, which is an identifier for the entire set of distinct information for an instance of dcterms:Location. This term differs from dwc:fieldNumber in that dwc:siteNumber is not related strictly to one dwc:Event. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples
  • USGS CENO LOC 21387
  • UCM 2025001
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:specificEpithet
Term IRI http://rs.tdwg.org/dwc/terms/specificEpithet
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/specificEpithet-2023-06-28
Label Specific Epithet
Definition The name of the first or species epithet of the dwc:scientificName.
Examples
  • concolor
  • gottschei
ABCD equivalence {DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Bacterial/SpeciesEpithet or DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Botanical/FirstEpithet or DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Zoological/SpeciesEpithet}
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-12-11_54
Term Name dwc:startDayOfYear
Term IRI http://rs.tdwg.org/dwc/terms/startDayOfYear
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/startDayOfYear-2026-05-26
Label Start Day Of Year
Definition The earliest integer day of the year on which a dwc:Event occurred.
Notes The value is 1 for January 1 and 365 for December 31, except in a leap year, in which case it is 366.
Examples
  • 1 (1 January)
  • 32 (1 February)
  • 366 (31 December)
  • 365 (30 December in a leap year, 31 December in a non-leap year)
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/DateTime/DayNumberBegin
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:StartTimeOfDay
Term IRI http://rs.tdwg.org/dwc/terms/StartTimeOfDay
Modified 2009-04-24
Label Start Time of Day
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/eventTime
Definition The time of day when the event began, expressed as decimal hours from midnight, local time.
Notes Examples: "12.0" (= noon), "13.5" (= 1:30pm)
ABCD equivalence accessible from DataSets/DataSet/Units/Unit/Gathering/ISODateTimeBegin
Type Property
Term Name dwc:stateProvince
Term IRI http://rs.tdwg.org/dwc/terms/stateProvince
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/stateProvince-2023-06-28
Label First Order Division
Definition The name of the next smaller administrative region than country (state, province, canton, department, region, etc.) in which the dcterms:Location occurs.
Notes Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names. Recommended best practice is to leave this field blank if the dcterms:Location spans multiple entities at this administrative level or if the dcterms:Location might be in one or another of multiple possible entities at this level. Multiplicity and uncertainty of the geographic entity can be captured either in the term dwc:higherGeography or in the term dwc:locality, or both.
Examples
  • Montana
  • Minas Gerais
  • Córdoba
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/NamedAreas/NamedArea/AreaName with NamedAreas/NamedArea/AreaClass= State or = Province (etc.)
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-06-28_40
Executive Committee decision http://rs.tdwg.org/decisions/decision-2024-02-28_43
Term Name dwc:subfamily
Term IRI http://rs.tdwg.org/dwc/terms/subfamily
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/subfamily-2023-06-28
Label Subfamily
Definition The full scientific name of the subfamily in which the dwc:Taxon is classified.
Examples
  • Periptyctinae
  • Orchidoideae
  • Sphindociinae
ABCD equivalence DataSets/DataSet/Units/Unit/Identifications/Identification/Result/TaxonIdentified/HigherTaxa/HigherTaxon/HigherTaxonName if DataSets/DataSet/Units/Unit/Identifications/Identification/Result/TaxonIdentified/HigherTaxa/HigherTaxon/HigherTaxonRank == "subfamilia"
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2021-07-15_34
Term Name dwc:subgenus
Term IRI http://rs.tdwg.org/dwc/terms/subgenus
Modified 2025-06-12
Term version IRI http://rs.tdwg.org/dwc/terms/version/subgenus-2025-06-12
Label Subgenus
Definition The full scientific name of the subgenus in which the dwc:Taxon is classified.
Notes A value for this term should be a complete subgenus name as required by the appropriate nomenclatural code.
Examples
  • Abacetus (Parastygis)
  • Dicranum subgen. Orthodicranum
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-06-12_44
Term Name dwc:subtribe
Term IRI http://rs.tdwg.org/dwc/terms/subtribe
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/subtribe-2023-06-28
Label Subtribe
Definition The full scientific name of the subtribe in which the dwc:Taxon is classified.
Examples
  • Plotinini
  • Typhaeini
ABCD equivalence ScientificNameIdentified/HigherTaxon/HigherTaxonRank (enumeration value: )
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-06-28_40
Term Name dwc:superfamily
Term IRI http://rs.tdwg.org/dwc/terms/superfamily
Modified 2023-07-07
Term version IRI http://rs.tdwg.org/dwc/terms/version/superfamily-2023-07-07
Label Superfamily
Definition The full scientific name of the superfamily in which the dwc:Taxon is classified.
Notes A taxonomic category subordinate to an order and superior to a family. According to ICZN article 29.2, the suffix -oidea is used for a superfamily name.
Examples
  • Achatinoidea
  • Cerithioidea
  • Helicoidea
  • Hypsibioidea
  • Valvatoidea
  • Zonitoidea
ABCD equivalence ScientificNameIdentified/HigherTaxon/HigherTaxonRank (enumeration value: superfamilia)
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-06-28_40
Term Name dwc:Taxon
Term IRI http://rs.tdwg.org/dwc/terms/Taxon
Modified 2023-09-18
Term version IRI http://rs.tdwg.org/dwc/terms/version/Taxon-2023-09-18
Label Taxon
Definition A group of organisms (sensu http://purl.obolibrary.org/obo/OBI_0100026) considered by taxonomists to form a homogeneous unit.
Examples the genus Truncorotaloides as published by Brönnimann et al. in 1953 in the Journal of Paleontology Vol. 27(6) p. 817-820
ABCD equivalence no simple equivalent in ABCD
Type Class
Executive Committee decision http://rs.tdwg.org/decisions/decision-2014-10-26_15
Term Name dwc:taxonAccordingTo
Term IRI http://rs.tdwg.org/dwc/terms/taxonAccordingTo
Modified 2009-09-21
Label Taxon According To
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/nameAccordingTo
Definition Information about the authorship of this taxon concept which uses the scientificName in their sense (secundum, sensu). Could be a publication (identification key), institution or team of individuals.
ABCD equivalence not in ABCD
Type Property
Term Name dwc:taxonAttributes
Term IRI http://rs.tdwg.org/dwc/terms/taxonAttributes
Modified 2009-10-09
Label Taxon Attributes
This term is deprecated and should no longer be used.
Definition A list (concatenated and separated) of additional measurements, facts, characteristics, or assertions about the taxon.
Notes Example: "iucnstatus=vulnerable; distribution=Neuquen, Argentina"
ABCD equivalence DataSets/DataSet/Units/Unit/Identifications/Identification/Result/TaxonIdentified/InformalNameString
Type Property
Term Name dwc:taxonConceptID
Term IRI http://rs.tdwg.org/dwc/terms/taxonConceptID
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/taxonConceptID-2023-06-28
Label Taxon Concept ID
Definition An identifier for the taxonomic concept to which the record refers - not for the nomenclatural details of a dwc:Taxon.
Examples 8fa58e08-08de-4ac1-b69c-1235340b7001
ABCD equivalence not in ABCD
Type Property
Term Name dwc:taxonFormula
Term IRI http://rs.tdwg.org/dwc/terms/taxonFormula
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/taxonFormula-2026-05-26
Label Taxon Formula
Definition A string representing the pattern to use to construct a dwc:Identification from dwc:Taxon names and identification qualifiers.
Notes Recommended best practice is to use a controlled vocabulary.
Examples
  • A
  • not A
  • A ?
  • A or B
  • A and B
  • A x B
  • A cf.
  • A aff.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwciri:taxonFormula
Term IRI http://rs.tdwg.org/dwc/iri/taxonFormula
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/iri/version/taxonFormula-2026-05-26
Label Taxon Formula (IRI)
Definition A pattern to use to construct a dwc:Identification from dwc:Taxon names and identification qualifiers.
Notes Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:TaxonID
Term IRI http://rs.tdwg.org/dwc/terms/TaxonID
Modified 2009-04-24
Label Taxon ID
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/taxonNameID
Definition A global unique identifier for the taxon (name in a classification).
ABCD equivalence not in ABCD
Type Property
Term Name dwc:taxonID
Term IRI http://rs.tdwg.org/dwc/terms/taxonID
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/taxonID-2026-05-26
Label Taxon ID
Definition An identifier for a dwc:Taxon.
Examples
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:taxonNameID
Term IRI http://rs.tdwg.org/dwc/terms/taxonNameID
Modified 2009-07-06
Label Taxon Name ID
This term is deprecated and should no longer be used.
Definition A unique identifier for the scientificName.
ABCD equivalence not in ABCD
Type Property
Term Name dwc:taxonomicStatus
Term IRI http://rs.tdwg.org/dwc/terms/taxonomicStatus
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/taxonomicStatus-2023-06-28
Label Taxonomic Status
Definition The status of the use of the dwc:scientificName as a label for a taxon. Requires taxonomic opinion to define the scope of a dwc:Taxon. Rules of priority then are used to define the taxonomic status of the nomenclature contained in that scope, combined with the experts opinion. It must be linked to a specific taxonomic reference that defines the concept.
Notes Recommended best practice is to use a controlled vocabulary.
Examples
  • invalid
  • misapplied
  • homotypic synonym
  • accepted
ABCD equivalence not in ABCD
Type Property
Term Name dwc:taxonRank
Term IRI http://rs.tdwg.org/dwc/terms/taxonRank
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/taxonRank-2026-05-26
Label Taxon Rank
Definition The taxonomic rank of the most specific name in the dwc:scientificName.
Notes Recommended best practice is to use a controlled vocabulary. The taxon ranks of algae, fungi and plants are defined in the International Code of Nomenclature for algae, fungi, and plants (Shenzhen Code Articles H3.2, H4.4 and H.3.1).
Examples
  • subspecies
  • varietas
  • forma
  • species
  • genus
  • nothogenus
  • nothospecies
  • nothosubspecies
ABCD equivalence DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Botanical/Rank
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-06-28_40
Executive Committee decision http://rs.tdwg.org/decisions/decision-2024-02-28_43
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:taxonRemarks
Term IRI http://rs.tdwg.org/dwc/terms/taxonRemarks
Modified 2017-10-06
Term version IRI http://rs.tdwg.org/dwc/terms/version/taxonRemarks-2017-10-06
Label Taxon Remarks
Definition Comments or notes about the taxon or name.
Examples this name is a misspelling in common use
ABCD equivalence not in ABCD
Type Property
Term Name dwciri:toDigitalSpecimen
Term IRI http://rs.tdwg.org/dwc/iri/toDigitalSpecimen
Modified 2025-06-12
Term version IRI http://rs.tdwg.org/dwc/iri/version/toDigitalSpecimen-2025-06-12
Label To Digital Specimen
Definition Use to link a dwc:Identification instance subject to a taxonomic entity such as a taxon, taxon concept, or taxon name use.
Notes Use to link a dwc:MaterialEntity instance subject to a Digital Specimem entity.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-06-12_44
Term Name dwciri:toTaxon
Term IRI http://rs.tdwg.org/dwc/iri/toTaxon
Modified 2015-03-27
Term version IRI http://rs.tdwg.org/dwc/iri/version/toTaxon-2015-03-27
Label To Taxon
Definition Use to link a dwc:Identification instance subject to a taxonomic entity such as a taxon, taxon concept, or taxon name use.
Notes A "convenience property" that replaces Darwin Core literal-value terms related to taxonomic entities. See Section 2.7.4 of the Darwin Core RDF Guide for details.
ABCD equivalence not in ABCD
Type Property
Term Name dwc:tribe
Term IRI http://rs.tdwg.org/dwc/terms/tribe
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/tribe-2023-06-28
Label Tribe
Definition The full scientific name of the tribe in which the dwc:Taxon is classified.
Examples
  • Ortaliini
  • Arethuseae
ABCD equivalence ScientificNameIdentified/HigherTaxon/HigherTaxonRank (enumeration value: )
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-06-28_40
Term Name dc:type
Term IRI http://purl.org/dc/elements/1.1/type
Modified 2025-06-12
Term version IRI http://dublincore.org/usage/terms/history/#type-006
Label Type
Definition The nature or genre of the resource.
Notes Must be populated with a value from the DCMI type vocabulary (https://www.dublincore.org/specifications/dublin-core/dcmi-type-vocabulary/2010-10-11/).
Examples
  • StillImage
  • MovingImage
  • Sound
  • PhysicalObject
  • Event
  • Text
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2019-12-01_19
Executive Committee decision http://rs.tdwg.org/decisions/decision-2019-12-01_20
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-06-12_44
Term Name dcterms:type
Term IRI http://purl.org/dc/terms/type
Modified 2008-01-14
Label Type
This term is deprecated and should no longer be used.
Is replaced by http://purl.org/dc/elements/1.1/type
Definition The nature or genre of the resource.
Notes To provide a string literal value for type, use dc:type rather than this term. In accordance with the Darwin Core RDF guide, rdf:type should be used instead of this term to indicate an IRI value for type.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2009-12-07_1
Executive Committee decision http://rs.tdwg.org/decisions/decision-2019-12-01_19
Executive Committee decision http://rs.tdwg.org/decisions/decision-2019-12-01_20
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-02-24_55
Term Name dwc:typeOfType
Term IRI http://rs.tdwg.org/dwc/terms/typeOfType
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/typeOfType-2026-05-26
Label Type Of Type
Definition A category of nomenclatural type of a dwc:MaterialEntity.
Notes The term dwc:typeOfType must be used in combination with dwc:typifiedName. Together they make up the type status of a specimen. Note that relatively very few specimens are nomenclatural types (types of names), so in most cases this term will have no value. Unlike dwc:typeStatus, dwc:typeOfType can only have a single value. Recommended best practice is to use a controlled vocabulary such as the GBIF Nomenclatural Type Status Vocabulary. This term has an equivalent in the tcs: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples
  • holotype
  • isotype
ABCD equivalence DataSets/DataSet/Units/Unit/SpecimenUnit/NomenclaturalTypeDesignations/TypeStatus
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:typeStatus
Term IRI http://rs.tdwg.org/dwc/terms/typeStatus
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/typeStatus-2023-06-28
Label Type Status
Definition A list (concatenated and separated) of nomenclatural types (type status, typified scientific name, publication) applied to the subject.
Notes Recommended best practice is to separate the values in a list with space vertical bar space ( | ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples
  • holotype of Ctenomys sociabilis. Pearson O. P., and M. I. Christie. 1985. Historia Natural, 5(37):388
  • holotype of Pinus abies | holotype of Picea abies
ABCD equivalence DataSets/DataSet/Units/Unit/SpecimenUnit/NomenclaturalTypeDesignations/NomenclaturalTypeText
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2014-10-30_16
Term Name dwciri:typeStatus
Term IRI http://rs.tdwg.org/dwc/iri/typeStatus
Modified 2025-07-10
Term version IRI http://rs.tdwg.org/dwc/iri/version/typeStatus-2025-07-10
Label Type Status (IRI)
Definition A nomenclatural type (type status, typified scientific name, publication) applied to the subject.
Notes Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-07-10_50
Term Name dwc:typifiedName
Term IRI http://rs.tdwg.org/dwc/terms/typifiedName
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/typifiedName-2026-05-26
Label Typified Name
Definition A scientific name for which a specimen or other name is the type.
Notes The term dwc:typifiedName must be used in combination with dwc:typeOfType. Together they make up the type status of a specimen. Note that relatively very few specimens are nomenclatural types (types of names), so in most cases this term will have no value. Unlike dwc:typeStatus, dwc:typifiedName can only have a single value, so a dwc:MaterialEntity can only have a single dwc:typifiedName.
Examples Polysiphonia amphibolis Womersley
ABCD equivalence DataSets/DataSet/Units/Unit/SpecimenUnit/NomenclaturalTypeDesignations/NomenclaturalTypeDesignation/TypifiedName
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-06-12_44
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:UsagePolicy
Term IRI http://rs.tdwg.org/dwc/terms/UsagePolicy
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/UsagePolicy-2026-05-26
Label Usage Policy
Definition Information about rights, usage, and attribution statements applicable to an entity.
Notes This is a convenience class to group related properties.
ABCD equivalence not in ABCD
Type Class
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:verbatimAssertionType
Term IRI http://rs.tdwg.org/dwc/terms/verbatimAssertionType
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/verbatimAssertionType-2026-05-26
Label Verbatim Assertion Type
Definition A string representing the type of dwc:Assertion as it appeared in an original record.
Notes This term is meant to allow the capture of an unaltered original name for a dwc:assertionType. This term is meant to be used in addition to dwc:assertionType, not instead of it.
Examples
  • water_temp
  • Fish biomass
  • sampling net mesh size
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:verbatimCoordinates
Term IRI http://rs.tdwg.org/dwc/terms/verbatimCoordinates
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/verbatimCoordinates-2026-05-26
Label Verbatim Coordinates
Definition Verbatim original spatial coordinates of a dcterms:Location.
Notes The coordinate ellipsoid, geodeticDatum, or full Spatial Reference System (SRS) for these coordinates should be stored in dwc:verbatimSRS and the coordinate system should be stored in dwc:verbatimCoordinateSystem.
Examples
  • 41 05 54S 121 05 34W
  • 17T 630000 4833400
ABCD equivalence {DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesLatLon/CoordinatesText or DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesUTM/UTMText}
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwciri:verbatimCoordinateSystem
Term IRI http://rs.tdwg.org/dwc/iri/verbatimCoordinateSystem
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/iri/version/verbatimCoordinateSystem-2026-05-26
Label Verbatim Coordinate System (IRI)
Definition A coordinate format for dwc:verbatimLatitude and dwc:verbatimLongitude or dwc:verbatimCoordinates.
Notes Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-07-10_50
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:verbatimCoordinateSystem
Term IRI http://rs.tdwg.org/dwc/terms/verbatimCoordinateSystem
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/verbatimCoordinateSystem-2026-05-26
Label Verbatim Coordinate System
Definition A coordinate format for dwc:verbatimLatitude and dwc:verbatimLongitude or dwc:verbatimCoordinates.
Notes Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples
  • decimal degrees
  • degrees decimal minutes
  • degrees minutes seconds
  • UTM
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesGrid/GridCellSystem
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:verbatimDepth
Term IRI http://rs.tdwg.org/dwc/terms/verbatimDepth
Modified 2017-10-06
Term version IRI http://rs.tdwg.org/dwc/terms/version/verbatimDepth-2017-10-06
Label Verbatim Depth
Definition The original description of the depth below the local surface.
Examples 100-200 m
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactText
Type Property
Term Name dwc:verbatimElevation
Term IRI http://rs.tdwg.org/dwc/terms/verbatimElevation
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/verbatimElevation-2026-05-26
Label Verbatim Elevation
Definition An original description of the elevation of a dcterms:Location.
Examples 100-200 m
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactText
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:verbatimEventDate
Term IRI http://rs.tdwg.org/dwc/terms/verbatimEventDate
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/verbatimEventDate-2023-06-28
Label Verbatim EventDate
Definition The verbatim original representation of the date and time information for a dwc:Event.
Examples
  • spring 1910
  • Marzo 2002
  • 1999-03-XX
  • 17IV1934
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/DateTime/DateText
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2024-02-28_43
Term Name dwc:verbatimIdentification
Term IRI http://rs.tdwg.org/dwc/terms/verbatimIdentification
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/verbatimIdentification-2023-06-28
Label Verbatim Identification
Definition A string representing the taxonomic identification as it appeared in the original record.
Notes This term is meant to allow the capture of an unaltered original identification/determination, including identification qualifiers, hybrid formulas, uncertainties, etc. This term is meant to be used in addition to dwc:scientificName (and dwc:identificationQualifier etc.), not instead of it.
Examples
  • Peromyscus sp.
  • Ministrymon sp. nov. 1
  • Anser anser × Branta canadensis
  • Pachyporidae?
  • Potentilla × pantotricha Soják
  • Aconitum pilipes × A. variegatum
  • Lepomis auritus x cyanellus
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2021-07-15_34
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-06-28_40
Term Name dwc:verbatimLabel
Term IRI http://rs.tdwg.org/dwc/terms/verbatimLabel
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/verbatimLabel-2026-05-26
Label Verbatim Label
Definition A verbatim original representation of the written information affixed or related to a dwc:MaterialEntity.
Notes The content of this term should include no embellishments, prefixes, headers or other additions made to the text. Abbreviations must not be expanded and supposed misspellings must not be corrected. Lines or breakpoints between blocks of text that could be verified by seeing the original labels or images of them may be used. Examples of material entities include preserved specimens, fossil specimens, and material samples. Best practice is to use UTF-8 for all characters. Best practice is to add comment “verbatimLabel derived from human transcription” in dwc:materialEntityRemarks. Examples can be found at https://dwc.tdwg.org/examples/verbatimLabel.
ABCD equivalence Marks/Mark/MarkText
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-06-28_40
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-09-13_41
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:verbatimLatitude
Term IRI http://rs.tdwg.org/dwc/terms/verbatimLatitude
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/verbatimLatitude-2026-05-26
Label Verbatim Latitude
Definition A verbatim original latitude of a dcterms:Location.
Notes The coordinate ellipsoid, geodeticDatum, or full Spatial Reference System (SRS) for these coordinates should be stored in dwc:verbatimSRS and the coordinate system should be stored in dwc:verbatimCoordinateSystem.
Examples 41 05 54.03S
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesLatLon/VerbatimLatitude
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:verbatimLocality
Term IRI http://rs.tdwg.org/dwc/terms/verbatimLocality
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/verbatimLocality-2026-05-26
Label Verbatim Locality
Definition An original textual description of a dcterms:Location.
Examples 25 km NNE Bariloche por R. Nac. 237
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/LocalityText
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:verbatimLongitude
Term IRI http://rs.tdwg.org/dwc/terms/verbatimLongitude
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/verbatimLongitude-2026-05-26
Label Verbatim Longitude
Definition A verbatim original longitude of a dcterms:Location.
Notes The coordinate ellipsoid, geodeticDatum, or full Spatial Reference System (SRS) for these coordinates should be stored in dwc:verbatimSRS and the coordinate system should be stored in dwc:verbatimCoordinateSystem.
Examples 121d 10' 34" W
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesLatLon/VerbatimLongitude
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:verbatimMeasurementType
Term IRI http://rs.tdwg.org/dwc/terms/verbatimMeasurementType
Modified 2025-06-12
Term version IRI http://rs.tdwg.org/dwc/terms/version/verbatimMeasurementType-2025-06-12
Label Verbatim Measurement Type
Definition A string representing the type of measurement or fact as it appeared in the original record.
Notes This term is meant to allow the capture of an unaltered original name for a measurement or fact type. This term is meant to be used in addition to dwc:measurementType, not instead of it.
Examples
  • water_temp
  • Fish biomass
  • sampling net mesh size
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-06-12_44
Term Name dwc:verbatimScientificNameRank
Term IRI http://rs.tdwg.org/dwc/terms/verbatimScientificNameRank
Modified 2009-09-21
Label Verbatim Scientific Name Rank
This term is deprecated and should no longer be used.
Is replaced by http://rs.tdwg.org/dwc/terms/verbatimTaxonRank
Definition The taxonomic rank of the most specific name in the scientificName as it appears in the original record.
Notes Examples: "Agamospecies", "sub-lesus", "prole", "apomict", "nothogrex".
ABCD equivalence not in ABCD
Type Property
Term Name dwciri:verbatimSRS
Term IRI http://rs.tdwg.org/dwc/iri/verbatimSRS
Modified 2025-06-12
Term version IRI http://rs.tdwg.org/dwc/iri/version/verbatimSRS-2025-06-12
Label Verbatim SRS (IRI)
Definition The ellipsoid, geodetic datum, or spatial reference system (SRS) upon which coordinates given in dwc:verbatimLatitude and dwc:verbatimLongitude, or dwc:verbatimCoordinates are based.
Notes Recommended best practice is to use an IRI for the EPSG code of the SRS, if known. Otherwise use a controlled vocabulary IRI for the name or code of the geodetic datum, if known. Otherwise use a controlled vocabulary IRI for the name or code of the ellipsoid, if known. Otherwise use an IRI for the value corresponding to not recorded.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-06-12_44
Term Name dwc:verbatimSRS
Term IRI http://rs.tdwg.org/dwc/terms/verbatimSRS
Modified 2025-06-12
Term version IRI http://rs.tdwg.org/dwc/terms/version/verbatimSRS-2025-06-12
Label Verbatim SRS
Definition The ellipsoid, geodetic datum, or spatial reference system (SRS) upon which coordinates given in dwc:verbatimLatitude and dwc:verbatimLongitude, or dwc:verbatimCoordinates are based.
Notes Recommended best practice is to use the EPSG code of the SRS, if known. Otherwise use a controlled vocabulary for the name or code of the geodetic datum, if known. Otherwise use a controlled vocabulary for the name or code of the ellipsoid, if known. If none of these is known, use the value not recorded. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples
  • EPSG:4326
  • WGS84
  • NAD27
  • Campo Inchauspe
  • European 1950
  • Clarke 1866
  • not recorded
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-06-12_44
Term Name dwc:verbatimTaxonRank
Term IRI http://rs.tdwg.org/dwc/terms/verbatimTaxonRank
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/verbatimTaxonRank-2023-06-28
Label Verbatim Taxon Rank
Definition The taxonomic rank of the most specific name in the dwc:scientificName as it appears in the original record.
Examples
  • Agamospecies
  • sub-lesus
  • prole
  • apomict
  • nothogrex
  • sp.
  • subsp.
  • var.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-12-11_54
Term Name dwc:vernacularName
Term IRI http://rs.tdwg.org/dwc/terms/vernacularName
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/vernacularName-2026-05-26
Label Vernacular Name
Definition A common or vernacular name.
Examples
  • cóndor andino
  • death cap
  • rainbow trout
  • Gänsegeier
  • smoky quartz
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2019-12-01_19
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:verticalDatum
Term IRI http://rs.tdwg.org/dwc/terms/verticalDatum
Modified 2025-06-12
Term version IRI http://rs.tdwg.org/dwc/terms/version/verticalDatum-2025-06-12
Label Vertical Datum
Definition The vertical datum used as the reference upon which the values in the elevation terms are based.
Notes Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples
  • EGM84
  • EGM96
  • EGM2008
  • PGM2000A
  • PGM2004
  • PGM2006
  • PGM2007
  • EPSG:7030
  • not recorded
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2021-07-15_34
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-06-12_44
Term Name dwciri:verticalDatum
Term IRI http://rs.tdwg.org/dwc/iri/verticalDatum
Modified 2025-07-10
Term version IRI http://rs.tdwg.org/dwc/iri/version/verticalDatum-2025-07-10
Label Vertical Datum (IRI)
Definition The vertical datum used as the reference upon which the values in the elevation terms are based.
Notes Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2021-07-15_34
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-07-10_50
Term Name dwciri:vitality
Term IRI http://rs.tdwg.org/dwc/iri/vitality
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/iri/version/vitality-2026-05-26
Label Vitality (IRI)
Definition An indication of whether a dwc:Organism was alive or dead at the time of collection or observation.
Notes Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-06-28_40
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-09-13_41
Executive Committee decision http://rs.tdwg.org/decisions/decision-2025-07-10_50
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:vitality
Term IRI http://rs.tdwg.org/dwc/terms/vitality
Modified 2026-05-26
Term version IRI http://rs.tdwg.org/dwc/terms/version/vitality-2026-05-26
Label Vitality
Definition An indication of whether a dwc:Organism was alive or dead at the time of collection or observation.
Notes Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples
  • alive
  • dead
  • mixedLot
  • uncertain
  • notAssessed
ABCD equivalence not in ABCD
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-06-28_40
Executive Committee decision http://rs.tdwg.org/decisions/decision-2023-09-13_41
Executive Committee decision http://rs.tdwg.org/decisions/decision-2026-05-26_58
Term Name dwc:waterBody
Term IRI http://rs.tdwg.org/dwc/terms/waterBody
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/waterBody-2023-06-28
Label Water Body
Definition The name of the water body in which the dcterms:Location occurs.
Notes Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names.
Examples
  • Indian Ocean
  • Baltic Sea
  • Hudson River
  • Lago Nahuel Huapi
ABCD equivalence DataSets/DataSet/Units/Unit/Gathering/NamedAreas/NamedArea/AreaName with NamedAreas/NamedArea/AreaClass= Water body
Type Property
Executive Committee decision http://rs.tdwg.org/decisions/decision-2024-02-28_43
Term Name dwc:year
Term IRI http://rs.tdwg.org/dwc/terms/year
Modified 2023-06-28
Term version IRI http://rs.tdwg.org/dwc/terms/version/year-2023-06-28
Label Year
Definition The four-digit year in which the dwc:Event occurred, according to the Common Era Calendar.
Examples
  • 1160
  • 2008
ABCD equivalence accessible from DataSets/DataSet/Units/Unit/Gathering/ISODateTimeBegin
Type Property