Lethal Infection of K18-hACE2 Mice Infected with Severe Acute Respiratory Syndrome Coronavirus

All animal studies were approved by the University of Iowa and the Veterans Administration Institutional Animal Care and Use committees. Mice transgenic for expression of hACE2 (K18-hACE2 mice) were generated as follows (see Fig. 1A). The hACE2 coding sequence was PCR amplified from IMAGE consortium clone ID 5243048 (ATCC, Manassas, VA) and cloned into the pCR2.1-TOPO vector (Invitrogen, Carlsbad, CA). The lacZ coding sequence in the previously described pK18mTElacZ-K18i6x7pA construct (16) (a kind gift from Jim Hu, Hospital for Sick Children, Toronto, Canada) was then replaced by the hACE2 coding sequence to create pK18-hACE2. 5′ of the hACE2 coding sequence, this plasmid contains 2.5 kb of upstream genomic sequence, the promoter, and the first intron (with a mutation in the 3′ splice acceptor site to reduce exon skipping) of the human cytokeratin 18 (K18) gene as well as a translational enhancer sequence from alfalfa mosaic virus. Downstream of the hACE2 coding sequence are exon 6, intron 6, exon 7, and the poly(A) signal of the human K18 gene. These elements were found to be necessary for high-level expression and epithelial cell specificity (4, 16). The purified 6.8-kb DNA fragment generated from an HpaI and XbaI double digest of pK18-hACE2 was used as the transgene for injection into pronuclei of fertilized (C57BL/6J × SJL/J)F₂ mouse eggs to generate transgenic embryos. Mice used in this study were backcrossed two to three times onto a C57BL/6 background. Tail DNA was obtained from mice using an Extract-N-Amp tissue PCR kit (Sigma-Aldrich, St. Louis, MO). Mice transgenic for hACE2 expression were detected by PCR analysis using forward primer ACCTGGCTGAAAGACCAGAACAAG and reverse primer AATTAGCCACTCGCACATCC.

Genomic DNA from each founder line of transgenic mouse and from wild-type mice was isolated from the liver using DNAzol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. One nanogram of genomic DNA and three consecutive 1:1 dilutions were used as a template for TaqMan quantitative PCR. The primers and probe specific for hACE2 are as follows: forward primer, TCCTAACCAGCCCCCTGTT; reverse primer, TGACAATGCCAACCACTATCACT; probe, ATATGGCTGATTGTTTTTGGAGTTGTGATGGG. A single-copy reference gene, mouse PKD1, was also quantified using the same templates and on the same reaction plate as hACE2. The primer and probe for mouse PKD1 are as follows: forward primer, GGCTGCTGAGCGTCTGGTA; reverse primer, CCAGGTCCTGCGTGTCTGA; probe, ATCATTGAAGGTGGCTCATACCGGGTATG. To normalize for the DNA added, a rodent glyceraldehyde-3-phosphate dehydrogenase (GAPDH) primer and probe set (Applied Biosystems) was also used in each reaction. Each genomic DNA quantitative PCR was run in duplicate in 25-μl reaction mixtures using the ABI 9700HT thermocycler. Primer and probe efficiency and compatibility were validated by relative efficiency plots of threshold cycles (C_T) from each DNA dilution for both the hACE2 and mouse PKD1 genes. To determine the hACE2 gene copy number in each transgenic mouse line, the \(2^{{-}{\Delta}{\Delta}C_{T}}\) method was performed using the PKD1 gene as an endogenous calibrator (1). The \(2^{{-}{\Delta}{\Delta}C_{T}}\) indicates the n-fold change in copy number of the hACE2 gene relative to the PKD1 gene, which is a single-copy gene in mice.

The Urbani strain of SARS-CoV was obtained from W. Bellini and T. Ksiazek at the Centers for Disease Control, Atlanta, GA. The virus was propagated and titered on Vero E6 cells in a biosafety level 3 laboratory. The titer of virus used for all studies, as determined by a plaque assay, was 7.6 × 10⁶ PFU/ml. Mice were lightly anesthetized with halothane and infected intranasally with the indicated dosage of SARS-CoV in 30μ l of Dulbecco's modified Eagle medium. Infected mice were examined and weighed daily. To obtain specimens for virus titers, animals were sacrificed and organs were aseptically removed into sterile phosphate-buffered saline. In some cases, blood was obtained via catheterization of the inferior vena cava. Tissues were homogenized using a manual homogenizer, and the 50% tissue culture infective dose (TCID₅₀) was determined as described previously (36).

Mice were euthanized with halothane, the chest was opened by midline incision, and lungs were lavaged in situ via PE-90 tubing inserted into the exposed trachea. Lungs were inflated with sterile saline to 25 cm H₂O by adding 0.5 ml at a time (total lavage volume, approximately 4 ml). The recovered cells were pelleted, resuspended in 1 ml Hanks buffer, counted, and spun for 5 min onto a glass slide. Cells were stained with a Diff-Quik stain set using standard techniques.

RNA was first extracted from mouse organs by using Trizol and then treated with RNase-free DNase I (Life Technologies, Gaithersburg, MD) for 30 min at 37°C. For each sample, 1 μg of total RNA was then used as a template for first-strand cDNA synthesis. The resulting cDNA was subjected to quantitative PCR amplification in the ABI 7900 sequence detection system to identify the hACE2 and rodent GAPDH amplicons and the mACE2 and rodent GAPDH amplicons in separate single reactions. Forward and reverse hACE2 and mACE2 primers and the fluorogenic TaqMan probe were designed using Primer Express software (Perkin-Elmer Applied Biosystems, Foster City, CA). Forward primers were 5′-TCCTAACCAGCCCCCTGTT-3′ for hACE2 and 5′-TCTGCCACCCCACAGCTT-3′ for mACE2; reverse primers were 5′-TGACAATGCCAACCACTATCACT-3′ for hACE2 and 5′-GGCTGTCAAGAAGTTGTCCATTG-3′ for mACE2; probes were 5′-ATATGGCTGATTGTTTTTGGAGTTGTGATGGG-3′for hACE2 and 5′-CACGGAGACTTCAGAATCAAGATC-5′for mACE2. The hACE2 and mACE2 probes are labeled with the fluorophore 6-carboxyfluorescein, and the rodent GAPDH probe is labeled with the fluorophore VIC. C_T for hACE2 and mACE2 were normalized against C_T for rodent GAPDH in each sample. A standard curve was generated using serial dilutions of hACE2 or mACE2 plasmids as the template in which 1 μg hACE2 plasmid DNA was determined to equal 1.2 × 10¹¹ molecules and 1 μg mACE2 plasmid DNA was determined to equal 4.5× 10¹¹ molecules. The copy number for each sample was determined by using the formula extrapolated from this standard curve.

To measure levels of viral RNA, an aliquot of cDNA was subjected to PCR using a MyiQ single-color real-time PCR detection system (Bio-Rad, Hercules, CA) with iQ SYBR green supermix (Bio-Rad). The following primers were used: for the SARS-CoV nucleocapsid (N) gene, forward/leader primer 5′-ATATTAGGTTTTTACCCAGG-3′ and reverse primer 5′-CTTGCCCCATTGCGTCCTCC-3′; for human hypoxanthine phosphoribosyltransferase (HPRT), forward primer 5′-CCTCATGGACTGATTATGGAC-3′ and reverse primer 5′-CAGATTCAACTTGCGCTCATC-3′. Data were analyzed as previously described (30).

Organs were harvested from infected and uninfected mice and fixed in zinc formalin. For routine histology, sections were stained with hematoxylin and eosin. To detect viral antigen, sections were probed with a monoclonal antibody (MAb) to the SARS-CoV N protein (1:5,000; Zymed, San Francisco, CA) or a control immunoglobulin G2a MAb (E-Bioscience, San Diego, CA) followed by a biotinylated goat anti-mouse secondary antibody (1:200; Jackson Immunoresearch, West Grove, PA). Samples were developed by sequential incubation with a streptavidin-horseradish peroxidase conjugate (Jackson Immunoresearch) and diaminobenzidine (Sigma-Aldrich).

Five micrograms of total RNA obtained from lungs or brains was analyzed by RNase protection assays using a custom set of probes purchased from BD PharMingen (San Diego, CA). After electrophoresis, gels were exposed to a phosphorimaging screen and analyzed using Bio-Rad Quantity One 4.4.0 software. Levels of RNA were normalized to those of a housekeeping gene (L32) in order to allow interanimal comparison of cytokine/chemokine mRNA levels.

In some cases, mice were treated intravenously with 25 mg of an anti-S neutralizing human MAb (MBL SARS-201; supplied by Donna Ambrosino, Massachusetts Biologic Laboratories) (10) per kg of body weight or a control humanized anti-respiratory syncytial virus MAb (palivizumab; Medimmune, Gaithersburg, MD) 1 day prior to infection.

hACE2 is expressed in human airway and alveolar epithelia (13), and SARS-CoV infects primary airway epithelial cells in vitro (14, 34). Since studies with nonhuman primates have shown that SARS-CoV infection began in airway epithelia (25), we generated transgenic mice in which hACE2 expression was driven by the K18 promoter as described in Materials and Methods (Fig. 1A). The K18 promoter confers efficient transgene expression in airway epithelial cells (but not in alveolar epithelia), as well as in epithelia of other internal organs, including the liver, kidney, and gastrointestinal tract (4). We generated three founder lines that transmitted the hACE2 gene to their progeny. Levels of transgene DNA in founder lines ranged from 4 to 10 copies per genome as determined by quantitative PCR (Fig. 1B). We detected hACE2 mRNA in several tissues, including the lung, colon, liver, and kidney (Fig. 2A and C), whereas endogenous mACE2 was most abundantly expressed in the ileum (8). Notably, very low but measurable levels of ACE2 were detected in the brains of both non-Tg and K18-hACE2 mice (Fig. 2B and C). Using lung sections and an antibody that detects both hACE2 and mACE2 in immunofluorescence assays, we detected ACE2 in airway epithelia in both non-Tg and K18-hACE2 mice, with no obvious differences in distribution (data not shown).

It was shown previously that intranasal inoculation of BALB/c or C57BL/6 mice with SARS-CoV resulted in minimal clinical disease, although C57BL/6 mice exhibited reduced weight gain after inoculation (9, 36). In agreement with these data, infection of non-Tg littermates resulted in no mortality or clinical disease, and mice gained weight over the course of the experiment (Fig. 3A and B). In marked contrast, K18-hACE2 mice inoculated intranasally with SARS-CoV began to lose weight by days 3 to 5 postinfection (p.i.). Concomitant with weight loss, mice became lethargic, with labored breathing. As shown in Fig. 3A, mice from all founder lines were dead by day 7 p.i., and nearly all mice from lines 1 and 2 were moribund by 4 days p.i. As noted above, mice from lines 1 and 2 contained the greatest number of hACE2 transgene copies. Since line 1 and line 2 mice exhibited nearly identical phenotypes, we used line 2 mice as representative of this more susceptible phenotype in the studies reported here.

Virus titers were 0.5 to 1 log unit higher in the lungs of K18-hACE2 mice than in those of their non-Tg littermates at day 2 p.i. and were higher in the lungs of K18-hACE2 mice that exhibited a more rapid disease course (line 2) than in those of mice surviving a few days longer (line 3) (Fig. 3C). While virus was partially cleared from the lungs of all mice by days 3 to 4 p.i., titers were 3 log units higher in K18-hACE2 mice than in non-Tg mice (line 3, day 4 p.i.; P < 0.0005). These results were confirmed by quantitative real-time RT-PCR, with higher levels of viral RNA present in the lung at 2 days p.i. than at 4 days p.i. (Fig. 4). Together, these data suggest that enhanced virus replication played a key role in the more severe disease observed in K18-hACE2 mice.

Although the K18 promoter is active in the epithelia of multiple organs, virus was not detected in the liver, kidney, or small intestine (ileum) at either 2 or 4 days p.i. (Fig. 3D). We also analyzed the brain for evidence of SARS-CoV, since the virus has been detected in patient brains in some studies (5, 11, 42) (Fig. 3D). Virus was never detected in the brains of non-Tg mice at days 2 to 4 p.i. In line 2 mice, virus was not detected in the brain at day 1 p.i. but was present at 2 days p.i. and was present at very high levels by 3 days p.i. Virus was also detected at low levels on day 2 and at high levels on day 4 p.i. in the brains of line 3 mice, even though levels of hACE2 mRNA in the brains of these mice were barely above background (Fig. 2B). Levels of viral RNA in the brain also increased dramatically from day 2 to day 4 p.i. (Fig. 4). Of note, SARS-CoV infects the brains of C57BL/6 mice at later times (9 days) p.i. (9), showing that the central nervous system (CNS) is a secondary site of infection even in non-Tg mice.

Mice were inoculated intranasally with 2.3 × 10⁴ PFU in these initial experiments. In subsequent experiments, we showed that virus was lethal at even lower dosages, since 3/3 and 5/6 mice (line 2) died after infection with 2.3 × 10³ PFU and 2.3 × 10² PFU, respectively. Thus, the 50% lethal dose of SARS-CoV for K18-hACE2 mice was less than 230 PFU after intranasal inoculation. SARS-CoV was not transmitted from moribund mice to uninfected K18-hACE2 mice (n = 4) housed in the same cages. This was not surprising, however, since mice do not cough or sneeze, and virus was not detected in the gastrointestinal tract or kidney.

To better understand the pulmonary lesions associated with the virulent phenotype of K18-hACE2 mice, we performed histologic analysis of the lungs. At day 2 p.i., both nontransgenic and K18-hACE2 mice showed evidence of perivascular and peribronchiolar inflammation (Fig. 5C and D). We observed more-widespread inflammatory cell infiltrates, increased inflammatory cell margination through vessels, more epithelial cell sloughing, and more signs of lung injury in infected K18-hACE2 mice (Fig. 5D) compared to their nontransgenic littermates (Fig. 5C). Staining for viral antigen revealed similar localization of SARS-CoV in the airway epithelia of the two groups of mice (Fig. 5E and F). By day 4 p.i., nontransgenic mice showed near-complete resolution of the pulmonary findings, with minimal evidence of inflammatory changes (Fig. 5I). In contrast, K18-hACE2 mice showed continued perivascular and peribronchial inflammation, hemorrhage, and congestion of alveolar septa (Fig. 5J). Staining for viral antigen was negative for both infected K18-hACE2 and non-Tg mice at day 4 p.i. (data not shown). These findings for the K18-hACE2 mouse share some features with the pulmonary lesions described for SARS patients, including modest mixed inflammatory cell infiltrates (11, 39), the detection of virus in conducting airway epithelia (11), alveolar septal thickening (39), and epithelial shedding and proliferation (7, 27). We saw no evidence of diffuse alveolar damage or acute respiratory distress syndrome, but it should be noted that patients with such findings commonly received assisted ventilation and supplemental oxygen, which complicate postmortem pulmonary findings.

In addition to the findings described above, patchy, intense neutrophilic infiltrates were noted in the lungs of some K18-hACE2 mice (Fig. 5L). These lesions obstructed the bronchioles with degenerate neutrophil aggregates and were associated with foci of necrotizing bronchopneumonia and alveolar flooding with seroproteinaceous fluid. In some areas, the neutrophilic inflammation was centered on foreign material (identical to esophageal contents), consistent with aspiration pneumonia (data not shown). We suspect that these aspiration events are neurogenic in nature, a consequence of pharyngeal and laryngeal dysfunction that may occur secondary to the spread of the virus to the CNS. Aspiration pneumonia has also been noted in mouse models of influenza infection (33) and occasionally for patients with SARS (26).

To characterize the inflammatory cell infiltrates observed in infected lungs, we obtained bronchoalveolar lavage (BAL) specimens from K18-hACE2 and non-Tg mice as described in Materials and Methods (Fig. 5G, H, and K). Total cell numbers were increased in lavage fluid from infected K18-hACE2 and non-Tg mice, and, as with SARS-CoV-infected patients (7, 26, 27), large numbers of macrophages were recovered in BAL specimens from infected mice. Macrophages from infected K18-hACE2 mice were larger than non-Tg macrophages and contained more vacuoles and cell debris in their cytoplasm, consistent with activation (Fig. 5G and H). Of note, we detected greater numbers of lymphocytes in BAL samples obtained from K18-hACE2 mice than in those from non-Tg mice. Low levels of neutrophils were also present in infected K18-hACE2 mice; neutrophils were not detected in infected human lungs, but no tissue samples were obtained prior to 5 day p.i. in any published report.

In agreement with the high levels of virus assayed in the brains of infected K18-hACE2 mice at day 4 p.i., we also detected viral antigen in large numbers of neurons throughout the cerebrum, thalamus, and brainstem, with relative sparing of the olfactory bulb and cerebellum (Fig. 6A and C). Although cytokeratin 18 is an epithelial cell protein, K18-based expression of a LacZ reporter in cortical and brainstem neurons has been reported previously (4). Infection of the CNS was accompanied by relatively minimal meningeal and perivascular infiltration (Fig. 6B), suggesting that mice died prior to a substantial cellular host immune response in the brain. No virus antigen was detected in the brains of non-Tg mice at day 4 p.i. (Fig. 6E) or in those of any mice at day 2 p.i.

Elevated levels of several cytokines and chemokines, including interleukin-1 (IL-1), IL-6, IL-12, CXCL8, CXCL10, and CCL2, were detected in the serum of SARS patients and may have contributed to clinical disease (15, 38, 40, 41, 43). Similarly, levels of several proinflammatory cytokine and chemokine mRNAs, including gamma interferon (IFN-γ), CXCL9, CXCL10, CCL2, and CCL7, were elevated in the lungs of K18-hACE2 mice and, to a lesser extent, in those of non-Tg mice at 2 days p.i.; in parallel with virus levels, levels of these cytokine and chemokine mRNAs were greatly diminished by 4 days p.i. (Fig. 7A and B). Conversely, no cytokine or chemokine mRNAs were elevated in the brain at day 2 p.i., but several, most notably IL-6, IFN-γ, CCL2, and CCL12, were detected at high levels in the infected K18-hACE2 CNS at day 4 p.i. (Fig. 7C). Remarkably, no IFN-α/β mRNA was detected in infected lungs, and only low levels of IFN-β mRNA were detected in the brain, consistent with the observation that SARS-CoV does not induce type 1 IFN in fibroblasts, macrophages, or dendritic cells (3, 20, 35).

To determine whether K18-hACE2 mice will be useful for evaluating anti-SARS-CoV therapy, animals were treated, as proof of principle, with a human MAb that binds to the hACE2 receptor binding domain of the SARS-CoV surface glycoprotein (MAb 201). MAb 201 has previously been shown to diminish virus replication and the severity of pathological changes in SARS-CoV-infected mice and hamsters (10, 31). Intravenous administration of MAb 201 (25 mg/kg of body weight), but not of a control antibody, to K18-hACE2 mice 1 day prior to SARS-CoV infection completely prevented death (Fig. 8), clinical disease, and weight loss (data not shown).